Regulon of SO0072 in Shewanella sp W3-18-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputw3181_4020
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Regulog:	SO0072 - Shewanellaceae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 7.1 Sequence: TGTATCAATGTATTAATACA Locus tag: Sputw3181_4020 Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily Locus tag: Sputw3181_4019 Name: SO0073 Funciton: ABC transporter, ATP-binding protein Locus tag: Sputw3181_4018 Name: SO0074 Funciton: ABC transporter permease protein
	Sputw3181_4020	SO0072	Transcriptional regulator, GntR family, YtrA subfamily
	Sputw3181_4019	SO0073	ABC transporter, ATP-binding protein
	Sputw3181_4018	SO0074	ABC transporter permease protein
Position: -79 Score: 7.1 Sequence: TGTATTAATACATTGATACA Locus tag: Sputw3181_4021 Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family Locus tag: Sputw3181_4022 Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component Locus tag: Sputw3181_4023 Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component Locus tag: Sputw3181_4024 Name: SO0068 Funciton: hypothetical protein
	Sputw3181_4021	PF00561	Hydrolase, alpha/beta hydrolase fold family
	Sputw3181_4022	COG4555	Putative ABC-type Na+ transport system, ATPase component
	Sputw3181_4023	COG1668	Predicted ABC-type Na+ efflux pump, permease component
	Sputw3181_4024	SO0068	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD