Regulon of SO0072 in Shewanella sp MR-7

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr7_0073
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Regulog:	SO0072 - Shewanellaceae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 7.1 Sequence: TGTATCAATGTATTAATACA Locus tag: Shewmr7_0073 Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily Locus tag: Shewmr7_0074 Name: SO0073 Funciton: ABC transporter, ATP-binding protein Locus tag: Shewmr7_0075 Name: SO0074 Funciton: ABC transporter permease protein
	Shewmr7_0073	SO0072	Transcriptional regulator, GntR family, YtrA subfamily
	Shewmr7_0074	SO0073	ABC transporter, ATP-binding protein
	Shewmr7_0075	SO0074	ABC transporter permease protein
Position: -78 Score: 7.1 Sequence: TGTATTAATACATTGATACA Locus tag: Shewmr7_0072 Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family Locus tag: Shewmr7_0071 Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component Locus tag: Shewmr7_0070 Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component Locus tag: Shewmr7_0069 Name: SO0068 Funciton: hypothetical protein
	Shewmr7_0072	PF00561	Hydrolase, alpha/beta hydrolase fold family
	Shewmr7_0071	COG4555	Putative ABC-type Na+ transport system, ATPase component
	Shewmr7_0070	COG1668	Predicted ABC-type Na+ efflux pump, permease component
	Shewmr7_0069	SO0068	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD