Statistics of regulated genes

Genome	Genes	Operons
Mycobacterium abscessus ATCC 19977	4	3
Mycobacterium avium 104	4	3
Mycobacterium flavescens PYR-GCK	5	4
Mycobacterium leprae TN	4	3
Mycobacterium marinum M	4	3
Mycobacterium smegmatis str. MC2 155	5	4
Mycobacterium sp. JLS	5	4
Mycobacterium tuberculosis H37Rv	4	3
Mycobacterium vanbaalenii PYR-1	5	4

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes										Function
CRON 1.
COG2331	* Mycobacterium abscessus ATCC 19977 Site: position = -63 score = 6.63899 sequence = CTAGCACTCCAAGCGGTAGAGTGCTAG Gene: MAB_1084c: Conserved hypothetical protein	* Mycobacterium avium 104 Site: position = -55 score = 6.84268 sequence = CTAGCACTTGACACGCTAGAGTGCTAA Gene: MAV_1100: Conserved hypothetical protein	* Mycobacterium flavescens PYR-GCK Site: position = -53 score = 6.77549 sequence = CTAGCACTTGAGCCGCTAGAGTGCTAA Gene: Mflv_1895: Conserved hypothetical protein	* Mycobacterium leprae TN Site: position = -54 score = 6.55582 sequence = CTAGCACTTGGCACGGTAGAGTGCCAG Gene: ML0180: Conserved hypothetical protein	* Mycobacterium marinum M Site: position = -55 score = 6.74941 sequence = CTAGCACTTGAAACGGTAGAGTGCTAA Gene: MMAR_4523: Conserved hypothetical protein	* Mycobacterium smegmatis str. MC2 155 Site: position = -55 score = 6.70683 sequence = CTAGCACTTGAGGCGGTAGAGTGCTAA Gene: MSMEG_5479: Conserved hypothetical protein	* Mycobacterium sp. JLS Site: position = -53 score = 6.81106 sequence = CTAGCACTTGAGCCGGTAGAGTGCTAA Gene: Mjls_4670: Conserved hypothetical protein	* Mycobacterium tuberculosis H37Rv Site: position = -54 score = 6.84268 sequence = CTAGCACTTGAGACGGTAGAGTGCTAA Gene: Rv0991c: Conserved hypothetical protein	* Mycobacterium vanbaalenii PYR-1 Site: position = -54 score = 6.84663 sequence = CTAGCACTTGACCCGGTAGAGTGCTAA Gene: Mvan_4835: Conserved hypothetical protein	Conserved hypothetical protein
CRON 2.
hsp18	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	* Mycobacterium flavescens PYR-GCK Site: position = -99 score = 6.81735 sequence = CTGGCACTCTCCTATCTCGAGTGCTAA Gene: Mflv_1805: Small heat shock protein 18	Mycobacterium leprae TN	Mycobacterium marinum M	* Mycobacterium smegmatis str. MC2 155 Site: position = -97 score = 6.9295 sequence = CTAGCACTCTCACATCTCGAGTGCTAA Gene: MSMEG_5611: Small heat shock protein 18	* Mycobacterium sp. JLS Site: position = -99 score = 7.0232 sequence = CTAGCACTCGCATGTGTCGAGTGCTAA Gene: Mjls_4761: Small heat shock protein 18	Mycobacterium tuberculosis H37Rv	* Mycobacterium vanbaalenii PYR-1 Site: position = -99 score = 6.71377 sequence = CTGGCACTCTCACAGCTCGAGTGCTAA Gene: Mvan_4943: Small heat shock protein 18	Small heat shock protein 18
CRON 3.
groS	* Mycobacterium abscessus ATCC 19977 Site: position = -162 score = 6.91802 sequence = CTAGCACTCTCATGTATAGAGTGCTAG Gene: MAB_3732c: Heat shock protein 60 family co-chaperone GroES	* Mycobacterium avium 104 Site: position = -160 score = 6.95812 sequence = CTAGCACTCGCATGTATAGAGTGCTAG Gene: MAV_4366: Heat shock protein 60 family co-chaperone GroES	* Mycobacterium flavescens PYR-GCK Site: position = -133 score = 7.01129 sequence = CTAGCACTCTCGTGTATAGAGTGCTAG Gene: Mflv_4925: Heat shock protein 60 family co-chaperone GroES	* Mycobacterium leprae TN Site: position = -236 score = 7.05139 sequence = CTAGCACTCGCGTGTATAGAGTGCTAG Gene: ML0380: Heat shock protein 60 family co-chaperone GroES	* Mycobacterium marinum M Site: position = -233 score = 6.91802 sequence = CTAGCACTCTCATGTATAGAGTGCTAG Gene: MMAR_1125: Heat shock protein 60 family co-chaperone GroES	* Mycobacterium smegmatis str. MC2 155 Site: position = -159 score = 6.91802 sequence = CTAGCACTCTCATGTATAGAGTGCTAG Gene: MSMEG_1582: Heat shock protein 60 family co-chaperone GroES	* Mycobacterium sp. JLS Site: position = -86 score = 6.95812 sequence = CTAGCACTCGCATGTATAGAGTGCTAG Gene: Mjls_1180: Heat shock protein 60 family co-chaperone GroES	* Mycobacterium tuberculosis H37Rv Site: position = -199 score = 6.91802 sequence = CTAGCACTCTCATGTATAGAGTGCTAG Gene: Rv3418c: Heat shock protein 60 family co-chaperone GroES	* Mycobacterium vanbaalenii PYR-1 Site: position = -131 score = 7.01129 sequence = CTAGCACTCTCGTGTATAGAGTGCTAG Gene: Mvan_1494: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groL	Mycobacterium abscessus ATCC 19977 Gene: MAB_3731c: Heat shock protein 60 family chaperone GroEL	Mycobacterium avium 104 Gene: MAV_4365: Heat shock protein 60 family chaperone GroEL	Mycobacterium flavescens PYR-GCK Gene: Mflv_4924: Heat shock protein 60 family chaperone GroEL	Mycobacterium leprae TN Gene: ML0381: Heat shock protein 60 family chaperone GroEL	Mycobacterium marinum M Gene: MMAR_1126: Heat shock protein 60 family chaperone GroEL	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_1583: Heat shock protein 60 family chaperone GroEL	Mycobacterium sp. JLS Gene: Mjls_1181: Heat shock protein 60 family chaperone GroEL	Mycobacterium tuberculosis H37Rv Gene: Rv3417c: Heat shock protein 60 family chaperone GroEL	Mycobacterium vanbaalenii PYR-1 Gene: Mvan_1495: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL
CRON 4.
groL2	* Mycobacterium abscessus ATCC 19977 Site: position = -131 score = 6.54916 sequence = TTGGCACTCACGACCGGTGAGTGCTAG Site: position = -166 score = 6.6848 sequence = CTTGCACTCGCCATGGCCGAGTGCTAA Gene: MAB_0650: Heat shock protein 60 family chaperone GroEL	* Mycobacterium avium 104 Site: position = -177 score = 6.6848 sequence = CTTGCACTCGGCATGGGCGAGTGCTAA Site: position = -143 score = 6.61943 sequence = TTGGCACTCGCGACCAGTGAGTGCTAG Gene: MAV_4707: Heat shock protein 60 family chaperone GroEL	* Mycobacterium flavescens PYR-GCK Site: position = -174 score = 6.87589 sequence = CTTGCACTCGCCCTGGTCGAGTGCTAA Site: position = -139 score = 6.61943 sequence = TTGGCACTCGCGACCAGTGAGTGCTAG Gene: Mflv_0141: Heat shock protein 60 family chaperone GroEL	* Mycobacterium leprae TN Site: position = -161 score = 6.62445 sequence = CTGGCACTCGCGATCAGCGAGTGCCAG Site: position = -196 score = 6.45946 sequence = CTTGCACTCGCCTTAGGGGAGTGCTAA Gene: ML0317: Heat shock protein 60 family chaperone GroEL	* Mycobacterium marinum M Site: position = -175 score = 6.87288 sequence = TTGGCACTCGCGACCCGCGAGTGCTAG Site: position = -210 score = 6.85063 sequence = CTTGCACTCGACATAGGCGAGTGCTAA Gene: MMAR_0759: Heat shock protein 60 family chaperone GroEL	* Mycobacterium smegmatis str. MC2 155 Site: position = -141 score = 6.71407 sequence = TTGGCACTCTCGATTCGTGAGTGCTAG Site: position = -176 score = 6.46959 sequence = CTTGCACTCACCATGCCCGAGTGCTAA Gene: MSMEG_0880: Heat shock protein 60 family chaperone GroEL	* Mycobacterium sp. JLS Site: position = -141 score = 6.81319 sequence = CTGGCACTCGCGACCGGTGAGTGCTAG Site: position = -176 score = 6.83579 sequence = CTTGCACTCTCCCTGGTCGAGTGCTAA Gene: Mjls_0598: Heat shock protein 60 family chaperone GroEL	* Mycobacterium tuberculosis H37Rv Site: position = -219 score = 6.62792 sequence = CTTGCACTCGGCATAGGCGAGTGCTAA Site: position = -184 score = 6.7288 sequence = TTGGCACTCGCGACCGGTGAGTGCTAG Gene: Rv0440: Heat shock protein 60 family chaperone GroEL	* Mycobacterium vanbaalenii PYR-1 Site: position = -175 score = 6.87589 sequence = CTTGCACTCGCCCAGGTCGAGTGCTAA Site: position = -140 score = 6.61943 sequence = TTGGCACTCGCGACCAGTGAGTGCTAG Gene: Mvan_0764: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD