Regulon of HrcA in Mycobacterium smegmatis str. MC2 155

Properties
Regulator type:	Transcription factor
TF locus tag:	MSMEG_4505
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Mycobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Mycobacteriaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 6.9 Sequence: CTAGCACTCTCACATCTCGAGTGCTAA Locus tag: MSMEG_5611 Name: hsp18 Funciton: Small heat shock protein 18
	MSMEG_5611	hsp18	Small heat shock protein 18
Position: -159 Score: 6.9 Sequence: CTAGCACTCTCATGTATAGAGTGCTAG Locus tag: MSMEG_1582 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: MSMEG_1583 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	MSMEG_1582	groS	Heat shock protein 60 family co-chaperone GroES
	MSMEG_1583	groL	Heat shock protein 60 family chaperone GroEL
Position: -55 Score: 6.7 Sequence: CTAGCACTTGAGGCGGTAGAGTGCTAA Locus tag: MSMEG_5479 Name: COG2331 Funciton: Conserved hypothetical protein
	MSMEG_5479	COG2331	Conserved hypothetical protein
Position: -176 Score: 6.5 Sequence: CTTGCACTCACCATGCCCGAGTGCTAA Position: -141 Score: 6.7 Sequence: TTGGCACTCTCGATTCGTGAGTGCTAG Locus tag: MSMEG_0880 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	MSMEG_0880	groL2	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD