Regulon of HrcA in Mycobacterium tuberculosis H37Rv

Properties
Regulator type:	Transcription factor
TF locus tag:	Rv2374c
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Mycobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Mycobacteriaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -199 Score: 6.9 Sequence: CTAGCACTCTCATGTATAGAGTGCTAG Locus tag: Rv3418c Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Rv3417c Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Rv3418c	groS	Heat shock protein 60 family co-chaperone GroES
	Rv3417c	groL	Heat shock protein 60 family chaperone GroEL
Position: -219 Score: 6.6 Sequence: CTTGCACTCGGCATAGGCGAGTGCTAA Position: -184 Score: 6.7 Sequence: TTGGCACTCGCGACCGGTGAGTGCTAG Locus tag: Rv0440 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Rv0440	groL2	Heat shock protein 60 family chaperone GroEL
Position: -54 Score: 6.8 Sequence: CTAGCACTTGAGACGGTAGAGTGCTAA Locus tag: Rv0991c Name: COG2331 Funciton: Conserved hypothetical protein
	Rv0991c	COG2331	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD