Regulon of HrcA in Mycobacterium avium 104

Properties
Regulator type:	Transcription factor
TF locus tag:	MAV_2022
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Mycobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Mycobacteriaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 6.8 Sequence: CTAGCACTTGACACGCTAGAGTGCTAA Locus tag: MAV_1100 Name: COG2331 Funciton: Conserved hypothetical protein
	MAV_1100	COG2331	Conserved hypothetical protein
Position: -177 Score: 6.7 Sequence: CTTGCACTCGGCATGGGCGAGTGCTAA Position: -143 Score: 6.6 Sequence: TTGGCACTCGCGACCAGTGAGTGCTAG Locus tag: MAV_4707 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	MAV_4707	groL2	Heat shock protein 60 family chaperone GroEL
Position: -160 Score: 7 Sequence: CTAGCACTCGCATGTATAGAGTGCTAG Locus tag: MAV_4366 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: MAV_4365 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	MAV_4366	groS	Heat shock protein 60 family co-chaperone GroES
	MAV_4365	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD