Regulon of HrcA in Mycobacterium abscessus ATCC 19977

Properties
Regulator type:	Transcription factor
TF locus tag:	MAB_1665
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Mycobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Mycobacteriaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 6.6 Sequence: CTAGCACTCCAAGCGGTAGAGTGCTAG Locus tag: MAB_1084c Name: COG2331 Funciton: Conserved hypothetical protein
	MAB_1084c	COG2331	Conserved hypothetical protein
Position: -166 Score: 6.7 Sequence: CTTGCACTCGCCATGGCCGAGTGCTAA Position: -131 Score: 6.5 Sequence: TTGGCACTCACGACCGGTGAGTGCTAG Locus tag: MAB_0650 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	MAB_0650	groL2	Heat shock protein 60 family chaperone GroEL
Position: -162 Score: 6.9 Sequence: CTAGCACTCTCATGTATAGAGTGCTAG Locus tag: MAB_3732c Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: MAB_3731c Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	MAB_3732c	groS	Heat shock protein 60 family co-chaperone GroES
	MAB_3731c	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD