Regulog Csac_2166 - Thermoanaerobacterales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermoanaerobacterales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Anaerocellum thermophilum DSM 6725 | 5 | 1 |
| Caldicellulosiruptor saccharolyticus DSM 8903 | 5 | 1 |
| Carboxydothermus hydrogenoformans Z-2901 | 4 | 1 |
| Moorella thermoacetica ATCC 39073 | ||
| Thermoanaerobacter ethanolicus X514 | 4 | 1 |
| Thermoanaerobacter italicus Ab9 | ||
| Thermoanaerobacter tengcongensis MB4 | 4 | 1 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| Csac_2166 |
*
Anaerocellum thermophilum DSM 6725 Site: position = -50 score = 7.50011 sequence = AGTGTTATATAATTATATAACACT Gene: Athe_0959: hypothetical protein |
*
Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -50 score = 7.50011 sequence = AGTGTTATATAATTATATAACACT Gene: Csac_2166: hypothetical protein |
*
Carboxydothermus hydrogenoformans Z-2901 Site: position = -50 score = 7.05463 sequence = ACTGTTATATAATTATATAACAGC Gene: CHY_0445: hypothetical protein |
|
*
Thermoanaerobacter ethanolicus X514 Site: position = -47 score = 7.40301 sequence = AGTGTTATATAATTATATAACAGT Gene: Teth514_0375: hypothetical protein |
|
*
Thermoanaerobacter tengcongensis MB4 Site: position = -49 score = 7.20744 sequence = ACTGTTATATTATTATATAACAGT Gene: TTE0439: hypothetical protein |
hypothetical protein |
| Csac_2166 |
Gene: Athe_0960: Transcriptional regulator, GntR family |
Gene: Csac_2165: Transcriptional regulator, GntR family |
Gene: CHY_0446: Transcriptional regulator, GntR family |
|
Gene: Teth514_0374: Transcriptional regulator, GntR family |
|
Gene: TTE0438: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| THA_1502 |
Gene: Athe_0961: ABC transporter, permease protein |
Gene: Csac_2164: ABC transporter, permease protein |
Gene: CHY_0447: ABC transporter, permease protein |
|
Gene: Teth514_0373: ABC transporter, permease protein |
|
Gene: TTE0437: ABC transporter, permease protein |
ABC transporter, permease protein |
| Athe_0962 |
Gene: Athe_0962: dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein |
Gene: Csac_2163: dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein |
|
|
|
|
|
dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein |
| THA_1501 |
Gene: Athe_0963: ABC transporter, ATP-binding protein |
Gene: Csac_2162: ABC transporter, ATP-binding protein |
Gene: CHY_0448: ABC transporter, ATP-binding protein |
|
Gene: Teth514_0372: ABC transporter, ATP-binding protein |
|
Gene: TTE0436: ABC transporter, ATP-binding protein |
ABC transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |