Statistics of regulated genes

Genome	Genes	Operons
Anaerocellum thermophilum DSM 6725	5	1
Caldicellulosiruptor saccharolyticus DSM 8903	5	1
Carboxydothermus hydrogenoformans Z-2901	4	1
Moorella thermoacetica ATCC 39073
Thermoanaerobacter ethanolicus X514	4	1
Thermoanaerobacter italicus Ab9
Thermoanaerobacter tengcongensis MB4	4	1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes								Function
CRON 1.
Csac_2166	* Anaerocellum thermophilum DSM 6725 Site: position = -50 score = 7.50011 sequence = AGTGTTATATAATTATATAACACT Gene: Athe_0959: hypothetical protein	* Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -50 score = 7.50011 sequence = AGTGTTATATAATTATATAACACT Gene: Csac_2166: hypothetical protein	* Carboxydothermus hydrogenoformans Z-2901 Site: position = -50 score = 7.05463 sequence = ACTGTTATATAATTATATAACAGC Gene: CHY_0445: hypothetical protein	Moorella thermoacetica ATCC 39073	* Thermoanaerobacter ethanolicus X514 Site: position = -47 score = 7.40301 sequence = AGTGTTATATAATTATATAACAGT Gene: Teth514_0375: hypothetical protein	Thermoanaerobacter italicus Ab9	* Thermoanaerobacter tengcongensis MB4 Site: position = -49 score = 7.20744 sequence = ACTGTTATATTATTATATAACAGT Gene: TTE0439: hypothetical protein	hypothetical protein
Csac_2166	Anaerocellum thermophilum DSM 6725 Gene: Athe_0960: Transcriptional regulator, GntR family	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_2165: Transcriptional regulator, GntR family	Carboxydothermus hydrogenoformans Z-2901 Gene: CHY_0446: Transcriptional regulator, GntR family	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_0374: Transcriptional regulator, GntR family	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4 Gene: TTE0438: Transcriptional regulator, GntR family	Transcriptional regulator, GntR family
THA_1502	Anaerocellum thermophilum DSM 6725 Gene: Athe_0961: ABC transporter, permease protein	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_2164: ABC transporter, permease protein	Carboxydothermus hydrogenoformans Z-2901 Gene: CHY_0447: ABC transporter, permease protein	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_0373: ABC transporter, permease protein	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4 Gene: TTE0437: ABC transporter, permease protein	ABC transporter, permease protein
Athe_0962	Anaerocellum thermophilum DSM 6725 Gene: Athe_0962: dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_2163: dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4	dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein
THA_1501	Anaerocellum thermophilum DSM 6725 Gene: Athe_0963: ABC transporter, ATP-binding protein	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_2162: ABC transporter, ATP-binding protein	Carboxydothermus hydrogenoformans Z-2901 Gene: CHY_0448: ABC transporter, ATP-binding protein	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_0372: ABC transporter, ATP-binding protein	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4 Gene: TTE0436: ABC transporter, ATP-binding protein	ABC transporter, ATP-binding protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD