Regulon of Csac_2166 in Anaerocellum thermophilum DSM 6725

Properties
Regulator type:	Transcription factor
TF locus tag:	Athe_0960
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	Csac_2166 - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 7.5 Sequence: AGTGTTATATAATTATATAACACT Locus tag: Athe_0959 Name: THA_1504 Funciton: hypothetical protein Locus tag: Athe_0960 Name: Csac_2166 Funciton: Transcriptional regulator, GntR family Locus tag: Athe_0961 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Athe_0962 Name: Athe_0962 Funciton: dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein Locus tag: Athe_0963 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
	Athe_0959	THA_1504	hypothetical protein
	Athe_0960	Csac_2166	Transcriptional regulator, GntR family
	Athe_0961	THA_1502	ABC transporter, permease protein
	Athe_0962	Athe_0962	dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein
	Athe_0963	THA_1501	ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD