Regulon of Csac_2166 in Thermoanaerobacter ethanolicus X514

Properties
Regulator type:	Transcription factor
TF locus tag:	Teth514_0374
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	Csac_2166 - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 7.4 Sequence: AGTGTTATATAATTATATAACAGT Locus tag: Teth514_0375 Name: THA_1504 Funciton: hypothetical protein Locus tag: Teth514_0374 Name: Csac_2166 Funciton: Transcriptional regulator, GntR family Locus tag: Teth514_0373 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Teth514_0372 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
	Teth514_0375	THA_1504	hypothetical protein
	Teth514_0374	Csac_2166	Transcriptional regulator, GntR family
	Teth514_0373	THA_1502	ABC transporter, permease protein
	Teth514_0372	THA_1501	ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD