Regulon of Csac_2166 in Thermoanaerobacter tengcongensis MB4

Properties
Regulator type:	Transcription factor
TF locus tag:	TTE0438
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	Csac_2166 - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 7.2 Sequence: ACTGTTATATTATTATATAACAGT Locus tag: TTE0439 Name: THA_1504 Funciton: hypothetical protein Locus tag: TTE0438 Name: Csac_2166 Funciton: Transcriptional regulator, GntR family Locus tag: TTE0437 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: TTE0436 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
	TTE0439	THA_1504	hypothetical protein
	TTE0438	Csac_2166	Transcriptional regulator, GntR family
	TTE0437	THA_1502	ABC transporter, permease protein
	TTE0436	THA_1501	ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD