Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing THA_1502 gene

Properties
Regulog: Csac_2166 - Thermoanaerobacterales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anaerocellum thermophilum DSM 6725
Position: -50
Score: 7.50011
Sequence: AGTGTTATATAATTATATAACACT
Locus tag: Athe_0959
Name: THA_1504
Funciton: hypothetical protein
Locus tag: Athe_0960
Name: Csac_2166
Funciton: Transcriptional regulator, GntR family
Locus tag: Athe_0961
Name: THA_1502
Funciton: ABC transporter, permease protein
Locus tag: Athe_0962
Name: Athe_0962
Funciton: dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein
Locus tag: Athe_0963
Name: THA_1501
Funciton: ABC transporter, ATP-binding protein
THA_1504-Csac_2166-THA_1502-Athe_0962-THA_1501 -50 7.5 AGTGTTATATAATTATATAACACT Athe_0959
Caldicellulosiruptor saccharolyticus DSM 8903
Position: -50
Score: 7.50011
Sequence: AGTGTTATATAATTATATAACACT
Locus tag: Csac_2166
Name: Csac_2166
Funciton: hypothetical protein
Locus tag: Csac_2165
Name: THA_1503
Funciton: Transcriptional regulator, GntR family
Locus tag: Csac_2164
Name: THA_1502
Funciton: ABC transporter, permease protein
Locus tag: Csac_2163
Name: Athe_0962
Funciton: dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein
Locus tag: Csac_2162
Name: THA_1501
Funciton: ABC transporter, ATP-binding protein
Csac_2166-THA_1503-THA_1502-Athe_0962-THA_1501 -50 7.5 AGTGTTATATAATTATATAACACT Csac_2166
Carboxydothermus hydrogenoformans Z-2901
Position: -50
Score: 7.05463
Sequence: ACTGTTATATAATTATATAACAGC
Locus tag: CHY_0445
Name: Csac_2166
Funciton: hypothetical protein
Locus tag: CHY_0446
Name: THA_1503
Funciton: Transcriptional regulator, GntR family
Locus tag: CHY_0447
Name: THA_1502
Funciton: ABC transporter, permease protein
Locus tag: CHY_0448
Name: THA_1501
Funciton: ABC transporter, ATP-binding protein
Csac_2166-THA_1503-THA_1502-THA_1501 -50 7.1 ACTGTTATATAATTATATAACAGC CHY_0445
Thermoanaerobacter ethanolicus X514
Position: -47
Score: 7.40301
Sequence: AGTGTTATATAATTATATAACAGT
Locus tag: Teth514_0375
Name: THA_1504
Funciton: hypothetical protein
Locus tag: Teth514_0374
Name: Csac_2166
Funciton: Transcriptional regulator, GntR family
Locus tag: Teth514_0373
Name: THA_1502
Funciton: ABC transporter, permease protein
Locus tag: Teth514_0372
Name: THA_1501
Funciton: ABC transporter, ATP-binding protein
THA_1504-Csac_2166-THA_1502-THA_1501 -47 7.4 AGTGTTATATAATTATATAACAGT Teth514_0375
Thermoanaerobacter tengcongensis MB4
Position: -49
Score: 7.20744
Sequence: ACTGTTATATTATTATATAACAGT
Locus tag: TTE0439
Name: THA_1504
Funciton: hypothetical protein
Locus tag: TTE0438
Name: Csac_2166
Funciton: Transcriptional regulator, GntR family
Locus tag: TTE0437
Name: THA_1502
Funciton: ABC transporter, permease protein
Locus tag: TTE0436
Name: THA_1501
Funciton: ABC transporter, ATP-binding protein
THA_1504-Csac_2166-THA_1502-THA_1501 -49 7.2 ACTGTTATATTATTATATAACAGT TTE0439