Regulog YhcF - Clostridia-1
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Clostridium acetobutylicum ATCC 824 | 6 | 2 |
| Clostridium beijerincki NCIMB 8052 | 3 | 1 |
| Clostridium botulinum A str. ATCC 3502 | 3 | 1 |
| Clostridium butyricum 5521 | 3 | 1 |
| Clostridium kluyveri DSM 555 | 4 | 2 |
| Clostridium novyi NT | 3 | 1 |
| Clostridium perfringens ATCC 13124 | 4 | 1 |
| Clostridium tetani E88 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| yhcG |
Gene: CAC0266: ABC-type multidrug transport system, ATPase component |
Gene: Cbei_0790: ABC-type multidrug transport system, ATPase component |
Gene: CBO0559: ABC-type multidrug transport system, ATPase component |
Gene: CBY_3924: ABC-type multidrug transport system, ATPase component |
Gene: CKL_2362: ABC-type multidrug transport system, ATPase component |
Gene: NT01CX_0787: ABC-type multidrug transport system, ATPase component |
*
Clostridium perfringens ATCC 13124 Site: position = -62 score = 6.87926 sequence = GTGTATTAATGAAGTAATACAT Site: position = -93 score = 6.66119 sequence = GTGTATTAGTGGTATAATACAC Gene: CPF_2288: ABC-type multidrug transport system, ATPase component |
Gene: CTC01987: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
| yhcI |
*
Clostridium acetobutylicum ATCC 824 Site: position = -65 score = 5.69358 sequence = GTGTATTATATACATAGTACAG Gene: CAC0264: ABC-type multidrug transport system, permease component |
Gene: Cbei_0789: ABC-type multidrug transport system, permease component |
Gene: CBO0560: ABC-type multidrug transport system, permease component |
Gene: CBY_3925: ABC-type multidrug transport system, permease component |
Gene: CKL_2361: ABC-type multidrug transport system, permease component |
Gene: NT01CX_0786: ABC-type multidrug transport system, permease component |
Gene: CPF_2287: ABC-type multidrug transport system, permease component |
|
ABC-type multidrug transport system, permease component |
| CPF_2286 |
|
|
|
|
|
|
Gene: CPF_2286: hypothetical protein |
|
hypothetical protein |
| yhcF |
Gene: CAC0265: Transcriptional regulator, GntR family |
*
Clostridium beijerincki NCIMB 8052 Site: position = -57 score = 4.9821 sequence = TTGTATTAACAACTTAGTACAA Gene: Cbei_0791: Transcriptional regulator, GntR family |
*
Clostridium botulinum A str. ATCC 3502 Site: position = -43 score = 5.24301 sequence = GTGTACTATTTAGATAGTACAG Gene: CBO0558A: Transcriptional regulator, GntR family |
*
Clostridium butyricum 5521 Site: position = -57 score = 5.13457 sequence = TTGTATTATAGACTTAGTACAA Gene: CBY_3923: Transcriptional regulator, GntR family |
*
Clostridium kluyveri DSM 555 Site: position = -44 score = 5.30675 sequence = GTGTATTATTATAATAGAACAC Gene: CKL_2363: Transcriptional regulator, GntR family |
*
Clostridium novyi NT Site: position = -64 score = 6.75001 sequence = GTGTATTAATATATTAATACAC Gene: NT01CX_0788: Transcriptional regulator, GntR family |
Gene: CPF_2285: Transcriptional regulator, GntR family |
|
Transcriptional regulator, GntR family |
| CRON 2. | |||||||||
| CAC3561 |
*
Clostridium acetobutylicum ATCC 824 Site: position = -174 score = 6.15532 sequence = GTGTACTATTTATGTAATACAC Gene: CAC3561: ABC-type transporter, permease component |
|
|
|
|
|
|
|
ABC-type transporter, permease component |
| CAC1998 |
Gene: CAC3560: ABC-type transporter, ATPase component |
|
|
|
|
|
|
|
ABC-type transport system, ATPase component |
| CAC3559 |
Gene: CAC3559: Membrane permease, predicted cation efflux pumps |
|
|
|
|
|
|
|
Membrane permease, predicted cation efflux pumps |
| CRON 3. | |||||||||
| CAC3585 |
|
|
|
|
*
Clostridium kluyveri DSM 555 Site: position = -69 score = 5.85045 sequence = GTGTATTATAACTATAGTACAC Gene: CKL_1661: ABC-type multidrug transport system, ATPase component |
|
|
|
ABC-type multidrug transport system, ATPase component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |