Regulon of YhcF in Clostridium perfringens ATCC 13124

Properties
Regulator type:	Transcription factor
TF locus tag:	CPF_2285
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Clostridia-1
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -93 Score: 6.7 Sequence: GTGTATTAGTGGTATAATACAC Position: -62 Score: 6.9 Sequence: GTGTATTAATGAAGTAATACAT Locus tag: CPF_2288 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CPF_2287 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: CPF_2286 Name: null Funciton: hypothetical protein Locus tag: CPF_2285 Name: yhcF Funciton: Transcriptional regulator, GntR family
	CPF_2288	yhcG	ABC-type multidrug transport system, ATPase component
	CPF_2287	yhcI	ABC-type multidrug transport system, permease component
	CPF_2286		hypothetical protein
	CPF_2285	yhcF	Transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD