Regulon of YhcF in Clostridium acetobutylicum ATCC 824

Properties
Regulator type:	Transcription factor
TF locus tag:	CAC0265
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Clostridia-1
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -174 Score: 6.2 Sequence: GTGTACTATTTATGTAATACAC Locus tag: CAC3561 Name: null Funciton: ABC-type transporter, permease component Locus tag: CAC3560 Name: null Funciton: ABC-type transporter, ATPase component Locus tag: CAC3559 Name: null Funciton: Membrane permease, predicted cation efflux pumps
	CAC3561		ABC-type transporter, permease component
	CAC3560		ABC-type transporter, ATPase component
	CAC3559		Membrane permease, predicted cation efflux pumps
Position: -65 Score: 5.7 Sequence: GTGTATTATATACATAGTACAG Locus tag: CAC0264 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: CAC0265 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: CAC0266 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component
	CAC0264	yhcI	ABC-type multidrug transport system, permease component
	CAC0265	yhcF	Transcriptional regulator, GntR family
	CAC0266	yhcG	ABC-type multidrug transport system, ATPase component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD