Regulon of YhcF in Clostridium novyi NT

Properties
Regulator type:	Transcription factor
TF locus tag:	NT01CX_0788
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Clostridia-1
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 6.8 Sequence: GTGTATTAATATATTAATACAC Locus tag: NT01CX_0788 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: NT01CX_0787 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: NT01CX_0786 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	NT01CX_0788	yhcF	Transcriptional regulator, GntR family
	NT01CX_0787	yhcG	ABC-type multidrug transport system, ATPase component
	NT01CX_0786	yhcI	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD