Regulon of YhcF in Clostridium botulinum A str. ATCC 3502

Properties
Regulator type:	Transcription factor
TF locus tag:	CBO0558A
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Clostridia-1
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 5.2 Sequence: GTGTACTATTTAGATAGTACAG Locus tag: CBO0558A Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: CBO0559 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CBO0560 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	CBO0558A	yhcF	Transcriptional regulator, GntR family
	CBO0559	yhcG	ABC-type multidrug transport system, ATPase component
	CBO0560	yhcI	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD