Regulon of YhcF in Clostridium kluyveri DSM 555

Properties
Regulator type:	Transcription factor
TF locus tag:	CKL_2363
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Clostridia-1
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 5.3 Sequence: GTGTATTATTATAATAGAACAC Locus tag: CKL_2363 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: CKL_2362 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CKL_2361 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	CKL_2363	yhcF	Transcriptional regulator, GntR family
	CKL_2362	yhcG	ABC-type multidrug transport system, ATPase component
	CKL_2361	yhcI	ABC-type multidrug transport system, permease component
Position: -69 Score: 5.9 Sequence: GTGTATTATAACTATAGTACAC Locus tag: CKL_1661 Name: CAC3585 Funciton: ABC-type multidrug transport system, ATPase component
	CKL_1661	CAC3585	ABC-type multidrug transport system, ATPase component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD