Regulog EbgR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | Beta-galactosides |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By TF family - LacI
- By effector - Beta-galactosides
- By pathway - Galactosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | 4 | 2 |
| Vibrio angustum S14 | 4 | 2 |
| Vibrio cholerae O1 biovar eltor str. N16961 | ||
| Vibrio fischeri ES114 | 6 | 4 |
| Vibrio harveyi ATCC BAA-1116 | 1 | 1 |
| Vibrio parahaemolyticus RIMD 2210633 | 3 | 2 |
| Vibrio salmonicida LFI1238 | ||
| Vibrio shilonii AK1 | 4 | 2 |
| Vibrio splendidus LGP32 | ||
| Vibrio vulnificus CMCP6 | 6 | 2 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| ebgR |
*
Photobacterium profundum SS9 Site: position = -191 score = 5.34455 sequence = GATAATTTTACTAAAACATCA Gene: PBPRA2083: Evolved beta-D-galactosidase transcriptional repressor, LacI family |
*
Vibrio angustum S14 Site: position = -109 score = 5.69497 sequence = AAAGTTTTTACTAAAAAAATT Site: position = -159 score = 4.60357 sequence = ATATTTATTATTATATTTTTT Site: position = -162 score = 4.51126 sequence = AATATATTTATTATTATATTT Gene: VAS14_15119: Evolved beta-D-galactosidase transcriptional repressor, LacI family |
|
*
Vibrio fischeri ES114 Site: position = -92 score = 4.91491 sequence = TAAAACTTTAGTAAAAGCCAT Gene: VF_A0348: Evolved beta-D-galactosidase transcriptional repressor, LacI family |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -104 score = 5.38777 sequence = CACAGTTTTACTAAAAATTTG Gene: VIBHAR_03334: Evolved beta-D-galactosidase transcriptional repressor, LacI family |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -102 score = 5.11275 sequence = CTCGATTTTACTAAAAGTTTG Gene: VP2402: Evolved beta-D-galactosidase transcriptional repressor, LacI family |
|
*
Vibrio shilonii AK1 Site: position = -104 score = 5.10152 sequence = GCTGTTTTTACTAAAATTTTA Gene: VSAK1_18699: Evolved beta-D-galactosidase transcriptional repressor, LacI family |
|
*
Vibrio vulnificus CMCP6 Site: position = -102 score = 4.28684 sequence = TCGATTTTTACTAAAAAAACG Gene: VV1_1769: Evolved beta-D-galactosidase transcriptional repressor, LacI family |
Evolved beta-D-galactosidase transcriptional repressor, LacI family |
| CRON 2. | |||||||||||
| ebgA |
*
Photobacterium profundum SS9 Site: position = -53 score = 4.2333 sequence = AAAACTTTAACTAACATAGCT Site: position = -65 score = 5.85953 sequence = ATTTATTTTACTAAAACTTTA Site: position = -332 score = 5.51316 sequence = TTGTATTTTACTAAAATTTAA Site: position = -78 score = 4.27578 sequence = AACAGATTTACCAATTTATTT Gene: PBPRA2084: Evolved beta-D-galactosidase, alpha subunit |
*
Vibrio angustum S14 Site: position = -118 score = 4.27045 sequence = AACGTTTTCACTAATTTATTT Site: position = -93 score = 5.7158 sequence = AAAACTTTTACTAAAATCGTT Site: position = -105 score = 6.05123 sequence = ATTTATTTTAGTAAAACTTTT Gene: VAS14_15114: Evolved beta-D-galactosidase, alpha subunit |
|
*
Vibrio fischeri ES114 Site: position = -67 score = 4.25079 sequence = GAGTTATTTACTACGATTTAT Site: position = -96 score = 4.45474 sequence = TAAAACTTTAGTTAATATCTT Site: position = -107 score = 5.74268 sequence = ATTTGTTTTACTAAAACTTTA Gene: VF_A0347: Evolved beta-D-galactosidase, alpha subunit |
Gene: VIBHAR_03337: Evolved beta-D-galactosidase, alpha subunit |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -168 score = 4.27045 sequence = AACGTTTTCACTAATTTATTT Site: position = -155 score = 6.05123 sequence = ATTTATTTTAGTAAAACTTTT Site: position = -143 score = 5.69517 sequence = AAAACTTTTACTAATATCTTT Gene: VP2403: Evolved beta-D-galactosidase, alpha subunit |
|
*
Vibrio shilonii AK1 Site: position = -98 score = 6.21684 sequence = ATATATTTTAGTAAAACTTTT Site: position = -86 score = 5.60403 sequence = AAAACTTTTACTAAAATTACC Gene: VSAK1_18704: Evolved beta-D-galactosidase, alpha subunit |
|
*
Vibrio vulnificus CMCP6 Site: position = -95 score = 5.90566 sequence = AAAAGTTTTACTAATATATTT Site: position = -107 score = 5.22269 sequence = ATTCTATTTAGTAAAAGTTTT Gene: VV1_1767: Evolved beta-D-galactosidase, alpha subunit |
Evolved beta-D-galactosidase, alpha subunit |
| ebgC |
Gene: PBPRA2085: Evolved beta-D-galactosidase, beta subunit |
Gene: VAS14_15109: Evolved beta-D-galactosidase, beta subunit |
|
Gene: VF_A0346: Evolved beta-D-galactosidase, beta subunit |
Gene: VIBHAR_03338: Evolved beta-D-galactosidase, beta subunit |
Gene: VP2404: Evolved beta-D-galactosidase, beta subunit |
|
Gene: VSAK1_18709: Evolved beta-D-galactosidase, beta subunit |
|
Gene: VV1_1766: Evolved beta-D-galactosidase, beta subunit |
Evolved beta-D-galactosidase, beta subunit |
| ygjI |
Gene: PBPRA2086: predicted beta-galactoside transporter, AAP family |
Gene: VAS14_15104: predicted beta-galactoside transporter, AAP family |
|
*2
Vibrio fischeri ES114 Site: position = -71 score = 5.34319 sequence = CTATAATTTACTAAAAGTTAC Site: position = -81 score = 4.8523 sequence = AAATTAATTACTATAATTTAC Site: position = -94 score = 5.85402 sequence = GTAACTTTTAGTAAAATTAAT Gene: VF_A0340: predicted beta-galactoside transporter, AAP family Gene: VF_A0345: predicted beta-galactoside transporter, AAP family |
Gene: VIBHAR_03339: predicted beta-galactoside transporter, AAP family |
|
|
Gene: VSAK1_18714: predicted beta-galactoside transporter, AAP family |
|
2
Vibrio vulnificus CMCP6 Gene: VV1_1765: predicted beta-galactoside transporter, AAP family Gene: VV1_1764: predicted beta-galactoside transporter, AAP family |
predicted beta-galactoside transporter, AAP family |
| SSF48208 |
|
|
|
*
Vibrio fischeri ES114 Site: position = -45 score = 5.50685 sequence = GTTAAATTTAGTAAAACTTTA Gene: VF_A0338: putative glucosyl hydrolase precursor |
|
|
|
|
|
Gene: VV1_1763: putative glucosyl hydrolase precursor |
putative glucosyl hydrolase precursor |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |