Regulon of EbgR in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_18699
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Regulog:	EbgR - Vibrionales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 5.1 Sequence: GCTGTTTTTACTAAAATTTTA Locus tag: VSAK1_18699 Name: ebgR Funciton: Evolved beta-D-galactosidase transcriptional repressor, LacI family
	VSAK1_18699	ebgR	Evolved beta-D-galactosidase transcriptional repressor, LacI family
Position: -98 Score: 6.2 Sequence: ATATATTTTAGTAAAACTTTT Position: -86 Score: 5.6 Sequence: AAAACTTTTACTAAAATTACC Locus tag: VSAK1_18704 Name: ebgA Funciton: Evolved beta-D-galactosidase, alpha subunit Locus tag: VSAK1_18709 Name: ebgC Funciton: Evolved beta-D-galactosidase, beta subunit Locus tag: VSAK1_18714 Name: ygjI Funciton: predicted beta-galactoside transporter, AAP family
	VSAK1_18704	ebgA	Evolved beta-D-galactosidase, alpha subunit
	VSAK1_18709	ebgC	Evolved beta-D-galactosidase, beta subunit
	VSAK1_18714	ygjI	predicted beta-galactoside transporter, AAP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD