Regulon of EbgR in Vibrio harveyi ATCC BAA-1116

Properties
Regulator type:	Transcription factor
TF locus tag:	VIBHAR_03334
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Regulog:	EbgR - Vibrionales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 5.4 Sequence: CACAGTTTTACTAAAAATTTG Locus tag: VIBHAR_03334 Name: ebgR Funciton: Evolved beta-D-galactosidase transcriptional repressor, LacI family
	VIBHAR_03334	ebgR	Evolved beta-D-galactosidase transcriptional repressor, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD