Regulog CueR - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | 3 | 2 |
| Acidovorax sp. JS42 | 6 | 4 |
| Comamonas testosteroni KF-1 | 2 | 1 |
| Delftia acidovorans SPH-1 | 3 | 2 |
| Leptothrix cholodnii SP-6 | ||
| Methylibium petroleiphilum PM1 | 8 | 5 |
| Polaromonas naphthalenivorans CJ2 | 3 | 2 |
| Polaromonas sp. JS666 | 6 | 4 |
| Rhodoferax ferrireducens DSM 15236 | 2 | 2 |
| Variovorax paradoxus S110 | 4 | 3 |
| Verminephrobacter eiseniae EF01-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| copA2 |
|
*
Acidovorax sp. JS42 Site: position = -64 score = 5.33325 sequence = ACCTTCCCACGATGGTAAGCC Gene: Ajs_1372: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: CtesDRAFT_4495: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Delftia acidovorans SPH-1 Site: position = -58 score = 4.877 sequence = ACCTTGACATGGTGGCAATCT Gene: Daci_5724: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
|
|
|
|
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| cueR3 |
|
Gene: Ajs_1373: Copper-responsive transcriptional regulator, MerR family |
|
|
|
|
|
|
|
|
|
Copper-responsive transcriptional regulator, MerR family |
| CRON 2. | ||||||||||||
| Mpe_A1644 |
|
|
|
|
|
*
Methylibium petroleiphilum PM1 Site: position = -81 score = 5.25854 sequence = ACCTTCCCACGTTGTCAAGGT Gene: Mpe_A1644: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| copA3 |
|
|
Gene: CtesDRAFT_1777: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
Gene: Mpe_A1645: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
|
|
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| CRON 3. | ||||||||||||
| copZ2 |
|
*
Acidovorax sp. JS42 Site: position = -65 score = 5.12475 sequence = ACCTTCCCACCGTGACAAGGC Gene: Ajs_1368: Copper chaperone |
|
|
Gene: Lcho_1834: Copper chaperone |
*2
Methylibium petroleiphilum PM1 Site: position = -57 score = 5.24 sequence = ACCTTCCAACAGTAGGAGGGT Gene: Mpe_A1641: Copper chaperone Site: position = -61 score = 5.46484 sequence = ACCTTCCCACCGGGGCAACGT Gene: Mpe_A3536: Copper chaperone |
*
Polaromonas naphthalenivorans CJ2 Site: position = -67 score = 5.48205 sequence = ACTTTGCCACCGTGGGAAGGT Gene: Pnap_4089: Copper chaperone |
*2
Polaromonas sp. JS666 Site: position = -218 score = 5.61164 sequence = ACCCTGCCCCCGTGGGAAGGT Gene: Bpro_4871: Copper chaperone Site: position = -26 score = 5.01024 sequence = ACCTTCCCACAGTCGGAAGCA Gene: Bpro_3497: Copper chaperone |
|
|
|
Copper chaperone |
| CRON 4. | ||||||||||||
| copZ |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -110 score = 4.8873 sequence = CCCCTGACATCATGGCAAGGT Gene: Aave_0033: Copper chaperone |
*
Acidovorax sp. JS42 Site: position = -140 score = 5.03886 sequence = ACCCTGACATGCTGGCAAGGT Gene: Ajs_0018: Copper chaperone |
*
Comamonas testosteroni KF-1 Site: position = -80 score = 4.94241 sequence = ACCTTGTCATGATGTTAGGGT Gene: CtesDRAFT_3915: Copper chaperone |
*
Delftia acidovorans SPH-1 Site: position = -77 score = 5.3267 sequence = ACCTTGCCATGGTGTCAGGGT Gene: Daci_0035: Copper chaperone |
|
|
|
|
|
*
Variovorax paradoxus S110 Site: position = -70 score = 4.94434 sequence = ACATTGACATCATGAGAAGGT Gene: Vapar_0030: Copper chaperone |
Gene: Veis_1021: Copper chaperone |
Copper chaperone |
| cueR |
Gene: Aave_0032: Copper resistance ranscriptional regulator, MerR family |
Gene: Ajs_0017: Copper resistance ranscriptional regulator, MerR family |
Gene: CtesDRAFT_3914: Copper resistance ranscriptional regulator, MerR family |
Gene: Daci_0034: Copper resistance ranscriptional regulator, MerR family |
|
|
|
|
*
Rhodoferax ferrireducens DSM 15236 Site: position = 12 score = 6.01477 sequence = ACCTTCCCACGGTGGCAAGGT Gene: Rfer_0023: Copper resistance ranscriptional regulator, MerR family |
Gene: Vapar_0029: Copper resistance ranscriptional regulator, MerR family |
|
Copper resistance ranscriptional regulator, MerR family |
| CRON 5. | ||||||||||||
| copA |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -34 score = 4.8873 sequence = ACCTTGCCATGATGTCAGGGG Gene: Aave_0034: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Acidovorax sp. JS42 Site: position = -58 score = 5.03886 sequence = ACCTTGCCAGCATGTCAGGGT Gene: Ajs_0019: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
Gene: Lcho_1835: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*2
Methylibium petroleiphilum PM1 Site: position = -34 score = 5.65196 sequence = ACTTTGCCATGATGGGAAGGT Gene: Mpe_A3535: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -59 score = 4.80881 sequence = ACCTTGCCATCGTTAGAACCT Gene: Mpe_A1640: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Polaromonas naphthalenivorans CJ2 Site: position = -82 score = 5.69883 sequence = ACCCTGCCATGATGGCAAGGT Gene: Pnap_4090: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*2
Polaromonas sp. JS666 Site: position = -84 score = 5.65003 sequence = ACCCTGCCATGATGGTAAGGT Gene: Bpro_4872: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -72 score = 5.37456 sequence = ACTTTCCAACAGTGGCAAGGT Gene: Bpro_3496: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -35 score = 5.81361 sequence = ACCTTGCCATGATGGGAAGGA Gene: Rfer_0024: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Variovorax paradoxus S110 Site: position = -34 score = 4.78556 sequence = ACCTTGCCATGATGTGAGACT Gene: Vapar_0031: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Veis_1058: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| cueR2 |
|
|
|
|
|
2
Methylibium petroleiphilum PM1 Gene: Mpe_A3534: Copper-responsive transcriptional regulator, MerR family Gene: Mpe_A1639: Copper-responsive transcriptional regulator, MerR family |
Gene: Pnap_4091: Copper-responsive transcriptional regulator, MerR family |
2
Polaromonas sp. JS666 Gene: Bpro_4873: Copper-responsive transcriptional regulator, MerR family Gene: Bpro_3495: Copper-responsive transcriptional regulator, MerR family |
|
*
Variovorax paradoxus S110 Site: position = -60 score = 4.63388 sequence = ACTCTCCCATGGTGTGAAGGC Gene: Vapar_2999: Copper-responsive transcriptional regulator, MerR family |
|
Copper-responsive transcriptional regulator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |