Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Mpe_A1644 gene

Properties
Regulog: CueR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/Beta
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Methylibium petroleiphilum PM1
Position: -81
Score: 5.25854
Sequence: ACCTTCCCACGTTGTCAAGGT
Locus tag: Mpe_A1644
Name: null
Funciton: hypothetical protein
Locus tag: Mpe_A1645
Name: copA3
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Mpe_A1644-copA3 -81 5.3 ACCTTCCCACGTTGTCAAGGT Mpe_A1644
© 2009-2020 RegPrecise