Regulon of CueR in Variovorax paradoxus S110

Properties
Regulator type:	Transcription factor
TF locus tag:	Vapar_2999, Vapar_0029
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Comamonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 4.6 Sequence: ACTCTCCCATGGTGTGAAGGC Locus tag: Vapar_2999 Name: cueR2 Funciton: Copper-responsive transcriptional regulator, MerR family
	Vapar_2999	cueR2	Copper-responsive transcriptional regulator, MerR family
Position: -34 Score: 4.8 Sequence: ACCTTGCCATGATGTGAGACT Locus tag: Vapar_0031 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	Vapar_0031	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -70 Score: 4.9 Sequence: ACATTGACATCATGAGAAGGT Locus tag: Vapar_0030 Name: copZ Funciton: Copper chaperone Locus tag: Vapar_0029 Name: cueR Funciton: Copper resistance ranscriptional regulator, MerR family
	Vapar_0030	copZ	Copper chaperone
	Vapar_0029	cueR	Copper resistance ranscriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD