Regulon of CueR in Methylibium petroleiphilum PM1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mpe_A3534, Mpe_A1639
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Comamonadaceae
Statistics of regulated genes:
- Genes	8
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 4.8 Sequence: ACCTTGCCATCGTTAGAACCT Locus tag: Mpe_A1640 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Mpe_A1639 Name: cueR2 Funciton: Copper-responsive transcriptional regulator, MerR family
	Mpe_A1640	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	Mpe_A1639	cueR2	Copper-responsive transcriptional regulator, MerR family
Position: -81 Score: 5.3 Sequence: ACCTTCCCACGTTGTCAAGGT Locus tag: Mpe_A1644 Name: null Funciton: hypothetical protein Locus tag: Mpe_A1645 Name: copA3 Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	Mpe_A1644		hypothetical protein
	Mpe_A1645	copA3	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -61 Score: 5.5 Sequence: ACCTTCCCACCGGGGCAACGT Locus tag: Mpe_A3536 Name: copZ2 Funciton: Copper chaperone
	Mpe_A3536	copZ2	Copper chaperone
Position: -57 Score: 5.2 Sequence: ACCTTCCAACAGTAGGAGGGT Locus tag: Mpe_A1641 Name: copZ2 Funciton: Copper chaperone
	Mpe_A1641	copZ2	Copper chaperone
Position: -34 Score: 5.7 Sequence: ACTTTGCCATGATGGGAAGGT Locus tag: Mpe_A3535 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Mpe_A3534 Name: cueR2 Funciton: Copper-responsive transcriptional regulator, MerR family
	Mpe_A3535	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	Mpe_A3534	cueR2	Copper-responsive transcriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD