Regulon of CueR in Acidovorax avenae subsp. citrulli AAC00-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Aave_0032
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -110 Score: 4.9 Sequence: CCCCTGACATCATGGCAAGGT Locus tag: Aave_0033 Name: copZ Funciton: Copper chaperone Locus tag: Aave_0032 Name: cueR Funciton: Copper resistance ranscriptional regulator, MerR family
	Aave_0033	copZ	Copper chaperone
	Aave_0032	cueR	Copper resistance ranscriptional regulator, MerR family
Position: -34 Score: 4.9 Sequence: ACCTTGCCATGATGTCAGGGG Locus tag: Aave_0034 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	Aave_0034	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD