Regulon of CueR in Polaromonas naphthalenivorans CJ2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pnap_4091
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -82 Score: 5.7 Sequence: ACCCTGCCATGATGGCAAGGT Locus tag: Pnap_4090 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Pnap_4091 Name: cueR2 Funciton: Copper-responsive transcriptional regulator, MerR family
	Pnap_4090	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	Pnap_4091	cueR2	Copper-responsive transcriptional regulator, MerR family
Position: -67 Score: 5.5 Sequence: ACTTTGCCACCGTGGGAAGGT Locus tag: Pnap_4089 Name: copZ2 Funciton: Copper chaperone
	Pnap_4089	copZ2	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD