Regulog NikR - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NikR
By TF family - NikR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345	7	3
Shewanella halifaxensis HAW-EB4	7	3
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3	6	2
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
omp_Ni	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	* Shewanella pealeana ATCC 700345 Site: position = -96 score = 7.13013 sequence = GTAATACTTTTTTAAAATTCGTCATAC Gene: Spea_1138: Predicted outer membrane nickel transporter, TonB-dependent family	* Shewanella halifaxensis HAW-EB4 Site: position = -138 score = 7.13013 sequence = GTAATACTTTTTTAAAATTCGTCATAC Gene: Shal_1183: Predicted outer membrane nickel transporter, TonB-dependent family	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_1673: Predicted outer membrane nickel transporter, TonB-dependent family	Shewanella woodyi ATCC 51908	Predicted outer membrane nickel transporter, TonB-dependent family

CRON 2.
nikR	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	* Shewanella pealeana ATCC 700345 Site: position = -164 score = 7.10802 sequence = GTAATACTATTTTTAGAATCGTCACAC Gene: Spea_3645: Nickel responsive regulator NikR, CopG family	* Shewanella halifaxensis HAW-EB4 Site: position = -164 score = 6.82165 sequence = GTAATACTATTTTTCGAATCGTCACAC Gene: Shal_3729: Nickel responsive regulator NikR, CopG family	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -167 score = 7.03082 sequence = GTAATACTACTTTTAGATTCGTAATAC Gene: Ssed_1674: Nickel responsive regulator NikR, CopG family	Shewanella woodyi ATCC 51908	Nickel responsive regulator NikR, CopG family

CRON 3.
nikA	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	* Shewanella pealeana ATCC 700345 Site: position = -49 score = 7.10802 sequence = GTGTGACGATTCTAAAAATAGTATTAC Gene: Spea_3644: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3)	* Shewanella halifaxensis HAW-EB4 Site: position = -49 score = 6.82165 sequence = GTGTGACGATTCGAAAAATAGTATTAC Gene: Shal_3728: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3)	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -56 score = 7.03082 sequence = GTATTACGAATCTAAAAGTAGTATTAC Gene: Ssed_1675: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3)	Shewanella woodyi ATCC 51908	Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3)
nikB	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_3643: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3727: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_1676: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3)	Shewanella woodyi ATCC 51908	Nickel transport system permease protein nikB2 (TC 3.A.1.5.3)
nikC	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_3642: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3726: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_1677: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3)	Shewanella woodyi ATCC 51908	Nickel transport system permease protein nikC2 (TC 3.A.1.5.3)
nikD	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_3641: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3725: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_1678: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2)	Shewanella woodyi ATCC 51908	Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2)
nikE	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_3640: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3724: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_1679: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)	Shewanella woodyi ATCC 51908	Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NikR - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --