Regulog NikR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | NikR |
| Regulation mode: | repressor |
| Biological process: | Nickel homeostasis |
| Effector: | Nickel ion, (Ni2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - NikR
- By TF family - NikR
- By effector - Nickel ion, (Ni2+)
- By pathway - Nickel homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | 7 | 3 |
| Shewanella halifaxensis HAW-EB4 | 7 | 3 |
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | 6 | 2 |
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| omp_Ni |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -96 score = 7.13013 sequence = GTAATACTTTTTTAAAATTCGTCATAC Gene: Spea_1138: Predicted outer membrane nickel transporter, TonB-dependent family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -138 score = 7.13013 sequence = GTAATACTTTTTTAAAATTCGTCATAC Gene: Shal_1183: Predicted outer membrane nickel transporter, TonB-dependent family |
|
Gene: Ssed_1673: Predicted outer membrane nickel transporter, TonB-dependent family |
|
Predicted outer membrane nickel transporter, TonB-dependent family |
| CRON 2. | |||||||||||||||||
| nikR |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -164 score = 7.10802 sequence = GTAATACTATTTTTAGAATCGTCACAC Gene: Spea_3645: Nickel responsive regulator NikR, CopG family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -164 score = 6.82165 sequence = GTAATACTATTTTTCGAATCGTCACAC Gene: Shal_3729: Nickel responsive regulator NikR, CopG family |
|
*
Shewanella sediminis HAW-EB3 Site: position = -167 score = 7.03082 sequence = GTAATACTACTTTTAGATTCGTAATAC Gene: Ssed_1674: Nickel responsive regulator NikR, CopG family |
|
Nickel responsive regulator NikR, CopG family |
| CRON 3. | |||||||||||||||||
| nikA |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -49 score = 7.10802 sequence = GTGTGACGATTCTAAAAATAGTATTAC Gene: Spea_3644: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -49 score = 6.82165 sequence = GTGTGACGATTCGAAAAATAGTATTAC Gene: Shal_3728: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3) |
|
*
Shewanella sediminis HAW-EB3 Site: position = -56 score = 7.03082 sequence = GTATTACGAATCTAAAAGTAGTATTAC Gene: Ssed_1675: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3) |
|
Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3) |
| nikB |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_3643: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3) |
Gene: Shal_3727: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3) |
|
Gene: Ssed_1676: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3) |
|
Nickel transport system permease protein nikB2 (TC 3.A.1.5.3) |
| nikC |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_3642: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3) |
Gene: Shal_3726: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3) |
|
Gene: Ssed_1677: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3) |
|
Nickel transport system permease protein nikC2 (TC 3.A.1.5.3) |
| nikD |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_3641: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2) |
Gene: Shal_3725: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2) |
|
Gene: Ssed_1678: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2) |
|
Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2) |
| nikE |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_3640: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2) |
Gene: Shal_3724: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2) |
|
Gene: Ssed_1679: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2) |
|
Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |