Regulon of NikR in Shewanella halifaxensis HAW-EB4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shal_3729
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Regulog:	NikR - Shewanellaceae
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NikR
By TF family - NikR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -138 Score: 7.1 Sequence: GTAATACTTTTTTAAAATTCGTCATAC Locus tag: Shal_1183 Name: omp_Ni Funciton: Predicted outer membrane nickel transporter, TonB-dependent family
	Shal_1183	omp_Ni	Predicted outer membrane nickel transporter, TonB-dependent family
Position: -49 Score: 6.8 Sequence: GTGTGACGATTCGAAAAATAGTATTAC Locus tag: Shal_3728 Name: nikA Funciton: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3) Locus tag: Shal_3727 Name: nikB Funciton: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3) Locus tag: Shal_3726 Name: nikC Funciton: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3) Locus tag: Shal_3725 Name: nikD Funciton: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2) Locus tag: Shal_3724 Name: nikE Funciton: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
	Shal_3728	nikA	Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3)
	Shal_3727	nikB	Nickel transport system permease protein nikB2 (TC 3.A.1.5.3)
	Shal_3726	nikC	Nickel transport system permease protein nikC2 (TC 3.A.1.5.3)
	Shal_3725	nikD	Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2)
	Shal_3724	nikE	Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
Position: -164 Score: 6.8 Sequence: GTAATACTATTTTTCGAATCGTCACAC Locus tag: Shal_3729 Name: nikR Funciton: Nickel responsive regulator NikR, CopG family
	Shal_3729	nikR	Nickel responsive regulator NikR, CopG family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD