Regulon of NikR in Shewanella sediminis HAW-EB3

Properties
Regulator type:	Transcription factor
TF locus tag:	Ssed_1674
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Regulog:	NikR - Shewanellaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NikR
By TF family - NikR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 7 Sequence: GTATTACGAATCTAAAAGTAGTATTAC Locus tag: Ssed_1675 Name: nikA Funciton: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3) Locus tag: Ssed_1676 Name: nikB Funciton: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3) Locus tag: Ssed_1677 Name: nikC Funciton: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3) Locus tag: Ssed_1678 Name: nikD Funciton: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2) Locus tag: Ssed_1679 Name: nikE Funciton: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
	Ssed_1675	nikA	Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3)
	Ssed_1676	nikB	Nickel transport system permease protein nikB2 (TC 3.A.1.5.3)
	Ssed_1677	nikC	Nickel transport system permease protein nikC2 (TC 3.A.1.5.3)
	Ssed_1678	nikD	Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2)
	Ssed_1679	nikE	Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
Position: -167 Score: 7 Sequence: GTAATACTACTTTTAGATTCGTAATAC Locus tag: Ssed_1674 Name: nikR Funciton: Nickel responsive regulator NikR, CopG family
	Ssed_1674	nikR	Nickel responsive regulator NikR, CopG family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD