Orthologous regulated operons containing nikA gene

Properties
Regulog:	NikR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Phylum:	Proteobacteria/gamma

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella halifaxensis HAW-EB4
Position: -49 Score: 6.82165 Sequence: GTGTGACGATTCGAAAAATAGTATTAC Locus tag: Shal_3728 Name: nikA Funciton: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3) Locus tag: Shal_3727 Name: nikB Funciton: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3) Locus tag: Shal_3726 Name: nikC Funciton: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3) Locus tag: Shal_3725 Name: nikD Funciton: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2) Locus tag: Shal_3724 Name: nikE Funciton: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
nikA-nikB-nikC-nikD-nikE	-49	6.8	GTGTGACGATTCGAAAAATAGTATTAC	Shal_3728
Shewanella pealeana ATCC 700345
Position: -49 Score: 7.10802 Sequence: GTGTGACGATTCTAAAAATAGTATTAC Locus tag: Spea_3644 Name: nikA Funciton: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3) Locus tag: Spea_3643 Name: nikB Funciton: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3) Locus tag: Spea_3642 Name: nikC Funciton: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3) Locus tag: Spea_3641 Name: nikD Funciton: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2) Locus tag: Spea_3640 Name: nikE Funciton: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
nikA-nikB-nikC-nikD-nikE	-49	7.1	GTGTGACGATTCTAAAAATAGTATTAC	Spea_3644
Shewanella sediminis HAW-EB3
Position: -56 Score: 7.03082 Sequence: GTATTACGAATCTAAAAGTAGTATTAC Locus tag: Ssed_1675 Name: nikA Funciton: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3) Locus tag: Ssed_1676 Name: nikB Funciton: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3) Locus tag: Ssed_1677 Name: nikC Funciton: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3) Locus tag: Ssed_1678 Name: nikD Funciton: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2) Locus tag: Ssed_1679 Name: nikE Funciton: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
nikA-nikB-nikC-nikD-nikE	-56	7	GTATTACGAATCTAAAAGTAGTATTAC	Ssed_1675