Regulon of NikR in Shewanella pealeana ATCC 700345

Properties
Regulator type:	Transcription factor
TF locus tag:	Spea_3645
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Regulog:	NikR - Shewanellaceae
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NikR
By TF family - NikR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -96 Score: 7.1 Sequence: GTAATACTTTTTTAAAATTCGTCATAC Locus tag: Spea_1138 Name: omp_Ni Funciton: Predicted outer membrane nickel transporter, TonB-dependent family
	Spea_1138	omp_Ni	Predicted outer membrane nickel transporter, TonB-dependent family
Position: -164 Score: 7.1 Sequence: GTAATACTATTTTTAGAATCGTCACAC Locus tag: Spea_3645 Name: nikR Funciton: Nickel responsive regulator NikR, CopG family
	Spea_3645	nikR	Nickel responsive regulator NikR, CopG family
Position: -49 Score: 7.1 Sequence: GTGTGACGATTCTAAAAATAGTATTAC Locus tag: Spea_3644 Name: nikA Funciton: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3) Locus tag: Spea_3643 Name: nikB Funciton: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3) Locus tag: Spea_3642 Name: nikC Funciton: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3) Locus tag: Spea_3641 Name: nikD Funciton: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2) Locus tag: Spea_3640 Name: nikE Funciton: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
	Spea_3644	nikA	Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3)
	Spea_3643	nikB	Nickel transport system permease protein nikB2 (TC 3.A.1.5.3)
	Spea_3642	nikC	Nickel transport system permease protein nikC2 (TC 3.A.1.5.3)
	Spea_3641	nikD	Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2)
	Spea_3640	nikE	Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD