Regulog AAur_4078 - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - LacI
- By pathway - Galactosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | 5 | 2 |
| Arthrobacter chlorophenolicus A6 | ||
| Arthrobacter sp. FB24 | ||
| Beutenbergia cavernae DSM 12333 | 6 | 2 |
| Brachybacterium faecium DSM 4810 | 11 | 3 |
| Brevibacterium linens BL2 | ||
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||
| Janibacter sp. HTCC2649 | ||
| Jonesia denitrificans DSM 20603 | 7 | 4 |
| Kocuria rhizophila DC2201 | ||
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| Bfae_04140 |
|
|
|
|
*
Brachybacterium faecium DSM 4810 Site: position = -121 score = 5.74681 sequence = TACTGTAATCGATCACAGTC Gene: Bfae_04140: Predicted galactosides ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
Predicted galactosides ABC transporter, substrate-binding protein |
| Bfae_04130 |
|
|
|
|
Gene: Bfae_04130: Predicted galactosides ABC transporter, permease protein 2 |
|
|
|
|
|
|
|
|
|
Predicted galactosides ABC transporter, permease protein 2 |
| Bfae_04120 |
|
|
|
|
Gene: Bfae_04120: Predicted galactosides ABC transporter, permease protein 1 |
|
|
|
|
|
|
|
|
|
Predicted galactosides ABC transporter, permease protein 1 |
| ganA3 |
|
|
|
|
2
Brachybacterium faecium DSM 4810 Gene: Bfae_04110: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) Gene: Bfae_04100: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
|
|
|
|
|
|
|
|
|
Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
| CRON 2. | |||||||||||||||
| ganA2 |
|
|
|
|
|
|
|
|
*
Jonesia denitrificans DSM 20603 Site: position = -49 score = 5.14695 sequence = GTCTGTGACCGGTCACAGAC Site: position = -136 score = 5.77052 sequence = CACTGGGAGCGGGCACAGTT Gene: Jden_2125: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
|
|
|
|
|
Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
| CRON 3. | |||||||||||||||
| SAV_1326 |
*
Arthrobacter aurescens TC1 Site: position = -177 score = 5.87147 sequence = AACTGTGTGCGCTCCCAGTA Site: position = -90 score = 5.9381 sequence = AACTGGAACCGCTCACAGTC Gene: AAur_4081: Predicted galactosides ABC transporter, substrate-binding protein |
|
|
|
*
Brachybacterium faecium DSM 4810 Site: position = -79 score = 5.86552 sequence = GACTGTAAACGATCACAGTT Site: position = -179 score = 4.90849 sequence = AACTGGAATCGATCACGGGT Gene: Bfae_04000: Predicted galactosides ABC transporter, substrate-binding protein |
|
|
|
*
Jonesia denitrificans DSM 20603 Site: position = -178 score = 5.549 sequence = CGCTGTGCGCGGTCACAGCC Site: position = -89 score = 5.52215 sequence = TCCTGTGACCGGTCACAGCG Gene: Jden_0310: Predicted galactosides ABC transporter, substrate-binding protein |
|
|
|
|
|
Predicted galactosides ABC transporter, substrate-binding protein |
| SAV_1327 |
Gene: AAur_4080: Predicted galactosides ABC transporter, permease protein 1 |
|
|
|
Gene: Bfae_04010: Predicted galactosides ABC transporter, permease protein 1 |
|
|
|
Gene: Jden_0309: Predicted galactosides ABC transporter, permease protein 1 |
|
|
|
|
|
Predicted galactosides ABC transporter, permease protein 1 |
| SAV_1328 |
Gene: AAur_4079: Predicted galactosides ABC transporter, permease protein 2 |
|
|
|
Gene: Bfae_04020: Predicted galactosides ABC transporter, permease protein 2 |
|
|
|
Gene: Jden_0308: Predicted galactosides ABC transporter, permease protein 2 |
|
|
|
|
|
Predicted galactosides ABC transporter, permease protein 2 |
| SAV_1329 |
Gene: AAur_4078: Predicted galactosides utilization transcriptional regulator, LacI-family |
|
|
*
Beutenbergia cavernae DSM 12333 Site: position = -73 score = 5.05964 sequence = AACCGTGATCGTGCACAGGA Site: position = -142 score = 5.3892 sequence = GGCTGGGACCGTGCACAGCA Gene: Bcav_3075: Predicted galactosides utilization transcriptional regulator, LacI-family |
Gene: Bfae_04030: Predicted galactosides utilization transcriptional regulator, LacI-family |
|
|
|
Gene: Jden_0307: Predicted galactosides utilization transcriptional regulator, LacI-family |
|
|
|
|
|
Predicted galactosides utilization transcriptional regulator, LacI-family |
| CRON 4. | |||||||||||||||
| lacA |
*
Arthrobacter aurescens TC1 Site: position = -123 score = 5.9381 sequence = GACTGTGAGCGGTTCCAGTT Site: position = -36 score = 5.87147 sequence = TACTGGGAGCGCACACAGTT Gene: AAur_4082: Beta-galactosidase (EC 3.2.1.23) |
|
|
*
Beutenbergia cavernae DSM 12333 Site: position = -147 score = 5.05964 sequence = TCCTGTGCACGATCACGGTT Site: position = -78 score = 5.3892 sequence = TGCTGTGCACGGTCCCAGCC Gene: Bcav_3076: Beta-galactosidase (EC 3.2.1.23) |
*
Brachybacterium faecium DSM 4810 Site: position = 3 score = 4.90849 sequence = ACCCGTGATCGATTCCAGTT Site: position = -97 score = 5.86552 sequence = AACTGTGATCGTTTACAGTC Gene: Bfae_03990: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
*
Jonesia denitrificans DSM 20603 Site: position = -154 score = 5.52215 sequence = CGCTGTGACCGGTCACAGGA Site: position = -65 score = 5.549 sequence = GGCTGTGACCGCGCACAGCG Gene: Jden_0311: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
|
|
Beta-galactosidase (EC 3.2.1.23) |
| Bcav_3077 |
|
|
|
Gene: Bcav_3077: Predicted galactosides ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
Predicted galactosides ABC transporter, substrate-binding protein |
| Bcav_3078 |
|
|
|
Gene: Bcav_3078: Predicted galactosides ABC transporter, permease protein |
|
|
|
|
|
|
|
|
|
|
Predicted galactosides ABC transporter, permease protein |
| Bcav_3079 |
|
|
|
Gene: Bcav_3079: Predicted galactosides ABC transporter, permease protein 2 |
|
|
|
|
|
|
|
|
|
|
Predicted galactosides ABC transporter, permease protein 2 |
| ganA |
|
|
|
Gene: Bcav_3080: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
Gene: Bfae_03980: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
|
|
|
*
Jonesia denitrificans DSM 20603 Site: position = -213 score = 6.02476 sequence = AACTGGGAGCGCGCACAGTC Site: position = -135 score = 5.45619 sequence = CCCTGTGACCGGTTACAGTA Gene: Jden_0385: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
|
|
|
|
|
Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |