Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Bfae_04130 gene

Properties
Regulog: AAur_4078 - Micrococcineae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector:
Phylum: Actinobacteria
Built upon 21 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Brachybacterium faecium DSM 4810
Position: -121
Score: 5.74681
Sequence: TACTGTAATCGATCACAGTC
Locus tag: Bfae_04140
Name: Bfae_04140
Funciton: Predicted galactosides ABC transporter, substrate-binding protein
Locus tag: Bfae_04130
Name: Bfae_04130
Funciton: Predicted galactosides ABC transporter, permease protein 2
Locus tag: Bfae_04120
Name: Bfae_04120
Funciton: Predicted galactosides ABC transporter, permease protein 1
Locus tag: Bfae_04110
Name: ganA3
Funciton: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
Locus tag: Bfae_04100
Name: ganA3
Funciton: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
Bfae_04140-Bfae_04130-Bfae_04120-ganA3-ganA3 -121 5.7 TACTGTAATCGATCACAGTC Bfae_04140