Regulon of AAur_4078 in Beutenbergia cavernae DSM 12333

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcav_3075
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:
Regulog:	AAur_4078 - Micrococcineae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -147 Score: 5.1 Sequence: TCCTGTGCACGATCACGGTT Position: -78 Score: 5.4 Sequence: TGCTGTGCACGGTCCCAGCC Locus tag: Bcav_3076 Name: lacA Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: Bcav_3077 Name: Bcav_3077 Funciton: Predicted galactosides ABC transporter, substrate-binding protein Locus tag: Bcav_3078 Name: Bcav_3078 Funciton: Predicted galactosides ABC transporter, permease protein Locus tag: Bcav_3079 Name: Bcav_3079 Funciton: Predicted galactosides ABC transporter, permease protein 2 Locus tag: Bcav_3080 Name: ganA Funciton: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
	Bcav_3076	lacA	Beta-galactosidase (EC 3.2.1.23)
	Bcav_3077	Bcav_3077	Predicted galactosides ABC transporter, substrate-binding protein
	Bcav_3078	Bcav_3078	Predicted galactosides ABC transporter, permease protein
	Bcav_3079	Bcav_3079	Predicted galactosides ABC transporter, permease protein 2
	Bcav_3080	ganA	Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
Position: -142 Score: 5.4 Sequence: GGCTGGGACCGTGCACAGCA Position: -73 Score: 5.1 Sequence: AACCGTGATCGTGCACAGGA Locus tag: Bcav_3075 Name: SAV_1329 Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family
	Bcav_3075	SAV_1329	Predicted galactosides utilization transcriptional regulator, LacI-family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD