Regulon of AAur_4078 in Jonesia denitrificans DSM 20603

Properties
Regulator type:	Transcription factor
TF locus tag:	Jden_0307
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:
Regulog:	AAur_4078 - Micrococcineae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -178 Score: 5.5 Sequence: CGCTGTGCGCGGTCACAGCC Position: -89 Score: 5.5 Sequence: TCCTGTGACCGGTCACAGCG Locus tag: Jden_0310 Name: SAV_1326 Funciton: Predicted galactosides ABC transporter, substrate-binding protein Locus tag: Jden_0309 Name: SAV_1327 Funciton: Predicted galactosides ABC transporter, permease protein 1 Locus tag: Jden_0308 Name: SAV_1328 Funciton: Predicted galactosides ABC transporter, permease protein 2 Locus tag: Jden_0307 Name: SAV_1329 Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family
	Jden_0310	SAV_1326	Predicted galactosides ABC transporter, substrate-binding protein
	Jden_0309	SAV_1327	Predicted galactosides ABC transporter, permease protein 1
	Jden_0308	SAV_1328	Predicted galactosides ABC transporter, permease protein 2
	Jden_0307	SAV_1329	Predicted galactosides utilization transcriptional regulator, LacI-family
Position: -213 Score: 6 Sequence: AACTGGGAGCGCGCACAGTC Position: -135 Score: 5.5 Sequence: CCCTGTGACCGGTTACAGTA Locus tag: Jden_0385 Name: ganA Funciton: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
	Jden_0385	ganA	Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
Position: -154 Score: 5.5 Sequence: CGCTGTGACCGGTCACAGGA Position: -65 Score: 5.5 Sequence: GGCTGTGACCGCGCACAGCG Locus tag: Jden_0311 Name: lacA Funciton: Beta-galactosidase (EC 3.2.1.23)
	Jden_0311	lacA	Beta-galactosidase (EC 3.2.1.23)
Position: -136 Score: 5.8 Sequence: CACTGGGAGCGGGCACAGTT Position: -49 Score: 5.1 Sequence: GTCTGTGACCGGTCACAGAC Locus tag: Jden_2125 Name: ganA2 Funciton: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
	Jden_2125	ganA2	Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD