Regulon of AAur_4078 in Arthrobacter aurescens TC1

Properties
Regulator type:	Transcription factor
TF locus tag:	AAur_4078
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:
Regulog:	AAur_4078 - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -177 Score: 5.9 Sequence: AACTGTGTGCGCTCCCAGTA Position: -90 Score: 5.9 Sequence: AACTGGAACCGCTCACAGTC Locus tag: AAur_4081 Name: SAV_1326 Funciton: Predicted galactosides ABC transporter, substrate-binding protein Locus tag: AAur_4080 Name: SAV_1327 Funciton: Predicted galactosides ABC transporter, permease protein 1 Locus tag: AAur_4079 Name: SAV_1328 Funciton: Predicted galactosides ABC transporter, permease protein 2 Locus tag: AAur_4078 Name: SAV_1329 Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family
	AAur_4081	SAV_1326	Predicted galactosides ABC transporter, substrate-binding protein
	AAur_4080	SAV_1327	Predicted galactosides ABC transporter, permease protein 1
	AAur_4079	SAV_1328	Predicted galactosides ABC transporter, permease protein 2
	AAur_4078	SAV_1329	Predicted galactosides utilization transcriptional regulator, LacI-family
Position: -123 Score: 5.9 Sequence: GACTGTGAGCGGTTCCAGTT Position: -36 Score: 5.9 Sequence: TACTGGGAGCGCACACAGTT Locus tag: AAur_4082 Name: lacA Funciton: Beta-galactosidase (EC 3.2.1.23)
	AAur_4082	lacA	Beta-galactosidase (EC 3.2.1.23)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD