Regulon of AAur_4078 in Brachybacterium faecium DSM 4810

Properties
Regulator type:	Transcription factor
TF locus tag:	Bfae_04030
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:
Regulog:	AAur_4078 - Micrococcineae
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 5.9 Sequence: AACTGTGATCGTTTACAGTC Position: 3 Score: 4.9 Sequence: ACCCGTGATCGATTCCAGTT Locus tag: Bfae_03990 Name: lacA Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: Bfae_03980 Name: ganA Funciton: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
	Bfae_03990	lacA	Beta-galactosidase (EC 3.2.1.23)
	Bfae_03980	ganA	Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
Position: -179 Score: 4.9 Sequence: AACTGGAATCGATCACGGGT Position: -79 Score: 5.9 Sequence: GACTGTAAACGATCACAGTT Locus tag: Bfae_04000 Name: SAV_1326 Funciton: Predicted galactosides ABC transporter, substrate-binding protein Locus tag: Bfae_04010 Name: SAV_1327 Funciton: Predicted galactosides ABC transporter, permease protein 1 Locus tag: Bfae_04020 Name: SAV_1328 Funciton: Predicted galactosides ABC transporter, permease protein 2 Locus tag: Bfae_04030 Name: SAV_1329 Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family
	Bfae_04000	SAV_1326	Predicted galactosides ABC transporter, substrate-binding protein
	Bfae_04010	SAV_1327	Predicted galactosides ABC transporter, permease protein 1
	Bfae_04020	SAV_1328	Predicted galactosides ABC transporter, permease protein 2
	Bfae_04030	SAV_1329	Predicted galactosides utilization transcriptional regulator, LacI-family
Position: -121 Score: 5.7 Sequence: TACTGTAATCGATCACAGTC Locus tag: Bfae_04140 Name: Bfae_04140 Funciton: Predicted galactosides ABC transporter, substrate-binding protein Locus tag: Bfae_04130 Name: Bfae_04130 Funciton: Predicted galactosides ABC transporter, permease protein 2 Locus tag: Bfae_04120 Name: Bfae_04120 Funciton: Predicted galactosides ABC transporter, permease protein 1 Locus tag: Bfae_04110 Name: ganA3 Funciton: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) Locus tag: Bfae_04100 Name: ganA3 Funciton: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
	Bfae_04140	Bfae_04140	Predicted galactosides ABC transporter, substrate-binding protein
	Bfae_04130	Bfae_04130	Predicted galactosides ABC transporter, permease protein 2
	Bfae_04120	Bfae_04120	Predicted galactosides ABC transporter, permease protein 1
	Bfae_04110	ganA3	Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
	Bfae_04100	ganA3	Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD