Regulog RhaR - Frankineae/Propionibacterineae/Pseudonocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
- By TF family - LacI
- By effector - Rhamnose
- By pathway - Rhamnose utilization
| Genome | Genes | Operons |
|---|---|---|
| Actinosynnema mirum DSM 43827 | 14 | 3 |
| Saccharopolyspora erythraea NRRL 2338 | 6 | 4 |
| Saccharomonospora viridis DSM 43017 | ||
| Nakamurella multipartita DSM 44233 | ||
| Frankia sp. EAN1pec | ||
| Frankia sp. CcI3 | ||
| Acidothermus cellulolyticus 11B | ||
| Nocardioides sp. JS614 | ||
| Propionibacterium acnes KPA171202 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| rhiL |
*
Actinosynnema mirum DSM 43827 Site: position = -132 score = 4.74619 sequence = CCTGTGAACCGATTCAACGC Site: position = -34 score = 5.07539 sequence = GGCTTGAACCGATTCAACCA Gene: Amir_0970: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
| rhiF |
Gene: Amir_0971: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
|
|
|
|
|
|
|
|
Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
| rhiG |
Gene: Amir_0972: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
|
|
|
|
|
|
|
|
Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
| Amir_0973 |
Gene: Amir_0973: hypothetical protein |
|
|
|
|
|
|
|
|
hypothetical protein |
| rhaM |
Gene: Amir_0974: L-rhamnose mutarotase |
|
|
|
|
|
|
|
|
L-rhamnose mutarotase |
| rhaR |
*2
Actinosynnema mirum DSM 43827 Gene: Amir_0975: Transcriptional regulator of rhamnose utilization, LacI family Site: position = -167 score = 5.09587 sequence = GGAATGAAAGGTTTCAATCT Site: position = -46 score = 4.61003 sequence = CGGCTAAATCGTTTCAAGCT Gene: Amir_3040: Transcriptional regulator of rhamnose utilization, LacI family |
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -45 score = 4.79299 sequence = GTCGTGAATCGTTTTACATC Gene: SACE_5204: Transcriptional regulator of rhamnose utilization, LacI family |
|
|
|
|
|
|
|
Transcriptional regulator of rhamnose utilization, LacI family |
| CRON 2. | ||||||||||
| rhaY |
|
*2
Saccharopolyspora erythraea NRRL 2338 Site: position = -116 score = 4.66511 sequence = GCTATAAATCGTTTCACAGG Gene: SACE_4106: Predicted L-rhamnose permease RhaY Site: position = -43 score = 4.86693 sequence = TGCCTGTAACGTTTCATCCA Gene: SACE_5203: Predicted L-rhamnose permease RhaY |
|
|
|
|
|
|
|
Predicted L-rhamnose permease RhaY |
| CRON 3. | ||||||||||
| rhaG |
*
Actinosynnema mirum DSM 43827 Site: position = -152 score = 4.61003 sequence = AGCTTGAAACGATTTAGCCG Site: position = -31 score = 5.09587 sequence = AGATTGAAACCTTTCATTCC Gene: Amir_3041: L-rhamnose ABC transporter, duplicated ATP-binding component |
|
|
|
|
|
|
|
|
L-rhamnose ABC transporter, duplicated ATP-binding component |
| rhaH |
Gene: Amir_3042: L-rhamnose ABC transporter, permease component 2 |
|
|
|
|
|
|
|
|
L-rhamnose ABC transporter, permease component 2 |
| rhaJ |
Gene: Amir_3043: L-rhamnose ABC transporter, permease component 1 |
|
|
|
|
|
|
|
|
L-rhamnose ABC transporter, permease component 1 |
| rhaF |
Gene: Amir_3044: L-rhamnose ABC transporter, duplicated periplasmic rhamnose-binding protein |
|
|
|
|
|
|
|
|
L-rhamnose ABC transporter, duplicated periplasmic rhamnose-binding protein |
| rhaI |
Gene: Amir_3045: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -328 score = 4.66511 sequence = CCTGTGAAACGATTTATAGC Gene: SACE_4105: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
|
|
Gene: Franean1_4673: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
|
|
|
|
Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
| rhaEW |
Gene: Amir_3046: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
Gene: SACE_4104: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
|
|
Gene: Franean1_4672: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
|
|
|
|
Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
| rhaB |
Gene: Amir_3047: Rhamnulokinase (EC 2.7.1.5) |
Gene: SACE_4103: Rhamnulokinase (EC 2.7.1.5) |
|
|
Gene: Franean1_4671: Rhamnulokinase (EC 2.7.1.5) |
|
|
|
|
Rhamnulokinase (EC 2.7.1.5) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |