Regulon of RhaR in Actinosynnema mirum DSM 43827

Properties
Regulator type:	Transcription factor
TF locus tag:	Amir_0975, Amir_3040
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose utilization
Effector:	Rhamnose
Regulog:	RhaR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	14
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - LacI
By effector - Rhamnose
By pathway - Rhamnose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -132 Score: 4.7 Sequence: CCTGTGAACCGATTCAACGC Position: -34 Score: 5.1 Sequence: GGCTTGAACCGATTCAACCA Locus tag: Amir_0970 Name: rhiL Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein Locus tag: Amir_0971 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1 Locus tag: Amir_0972 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: Amir_0973 Name: null Funciton: hypothetical protein Locus tag: Amir_0974 Name: rhaM Funciton: L-rhamnose mutarotase Locus tag: Amir_0975 Name: rhaR Funciton: Transcriptional regulator of rhamnose utilization, LacI family
	Amir_0970	rhiL	Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
	Amir_0971	rhiF	Putatuve rhamnogalacturonides ABC transporter, permease component 1
	Amir_0972	rhiG	Putatuve rhamnogalacturonides ABC transporter, permease component 2
	Amir_0973		hypothetical protein
	Amir_0974	rhaM	L-rhamnose mutarotase
	Amir_0975	rhaR	Transcriptional regulator of rhamnose utilization, LacI family
Position: -167 Score: 5.1 Sequence: GGAATGAAAGGTTTCAATCT Position: -46 Score: 4.6 Sequence: CGGCTAAATCGTTTCAAGCT Locus tag: Amir_3040 Name: rhaR Funciton: Transcriptional regulator of rhamnose utilization, LacI family
	Amir_3040	rhaR	Transcriptional regulator of rhamnose utilization, LacI family
Position: -152 Score: 4.6 Sequence: AGCTTGAAACGATTTAGCCG Position: -31 Score: 5.1 Sequence: AGATTGAAACCTTTCATTCC Locus tag: Amir_3041 Name: rhaG Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component Locus tag: Amir_3042 Name: rhaH Funciton: L-rhamnose ABC transporter, permease component 2 Locus tag: Amir_3043 Name: rhaJ Funciton: L-rhamnose ABC transporter, permease component 1 Locus tag: Amir_3044 Name: rhaF Funciton: L-rhamnose ABC transporter, duplicated periplasmic rhamnose-binding protein Locus tag: Amir_3045 Name: rhaI Funciton: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) Locus tag: Amir_3046 Name: rhaEW Funciton: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) Locus tag: Amir_3047 Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5)
	Amir_3041	rhaG	L-rhamnose ABC transporter, duplicated ATP-binding component
	Amir_3042	rhaH	L-rhamnose ABC transporter, permease component 2
	Amir_3043	rhaJ	L-rhamnose ABC transporter, permease component 1
	Amir_3044	rhaF	L-rhamnose ABC transporter, duplicated periplasmic rhamnose-binding protein
	Amir_3045	rhaI	Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14)
	Amir_3046	rhaEW	Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22)
	Amir_3047	rhaB	Rhamnulokinase (EC 2.7.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD