Regulog BglR - Vibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Statistics of regulated genes
Genome	Genes	Operons
Photobacterium profundum SS9
Vibrio angustum S14
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio fischeri ES114
Vibrio harveyi ATCC BAA-1116	8	2
Vibrio parahaemolyticus RIMD 2210633
Vibrio salmonicida LFI1238
Vibrio shilonii AK1
Vibrio splendidus LGP32	8	2
Vibrio vulnificus CMCP6	7	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
bglR	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	* Vibrio harveyi ATCC BAA-1116 Site: position = -60 score = 5.46461 sequence = CCATGAAAGCGGTTTCGGAG Gene: VIBHAR_06943: Transcriptional regulator for beta-glucoside utilization, LacI family	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -41 score = 5.00469 sequence = TTTTGTAAGCGGTTACAAGC Site: position = -140 score = 5.65031 sequence = ATCTGTAAGCGCTTTCATGA Gene: VS_II1392: Transcriptional regulator for beta-glucoside utilization, LacI family	* Vibrio vulnificus CMCP6 Site: position = -48 score = 5.57639 sequence = GCATGAAAGCGGTTTCGAAA Gene: VV21282: Transcriptional regulator for beta-glucoside utilization, LacI family	Transcriptional regulator for beta-glucoside utilization, LacI family
bglE	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	2 Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06941: Predicted beta-glucoside ABC transporter, periplasmic component Gene: VIBHAR_06942: Predicted beta-glucoside ABC transporter, periplasmic component	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1391: Predicted beta-glucoside ABC transporter, periplasmic component	Vibrio vulnificus CMCP6 Gene: VV21283: Predicted beta-glucoside ABC transporter, periplasmic component	Predicted beta-glucoside ABC transporter, periplasmic component
bglF	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06940: Predicted beta-glucoside ABC transporter, permease component	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1390: Predicted beta-glucoside ABC transporter, permease component	Vibrio vulnificus CMCP6 Gene: VV21284: Predicted beta-glucoside ABC transporter, permease component	Predicted beta-glucoside ABC transporter, permease component
bglG	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06939: Predicted beta-glucoside ABC transporter, permease component	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1389: Predicted beta-glucoside ABC transporter, permease component	Vibrio vulnificus CMCP6 Gene: VV21286: Predicted beta-glucoside ABC transporter, permease component	Predicted beta-glucoside ABC transporter, permease component
bglB	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06938: Beta-glucosidase (EC 3.2.1.21)	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1388: Beta-glucosidase (EC 3.2.1.21)	Vibrio vulnificus CMCP6 Gene: VV21287: Beta-glucosidase (EC 3.2.1.21)	Beta-glucosidase (EC 3.2.1.21)
bglK	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06937: Predicted beta-glucoside ABC transporter, ATP-binding protein	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1387: Predicted beta-glucoside ABC transporter, ATP-binding protein	Vibrio vulnificus CMCP6 Gene: VV21288: Predicted beta-glucoside ABC transporter, ATP-binding protein	Predicted beta-glucoside ABC transporter, ATP-binding protein
VS_II1386	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1386: Cellodextrin-phosphorylase (EC 2.4.1.49)	Vibrio vulnificus CMCP6	Cellodextrin-phosphorylase (EC 2.4.1.49)

CRON 2.
bglP	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	* Vibrio harveyi ATCC BAA-1116 Site: position = -206 score = 6.1657 sequence = AAATGAAAGCGATTTCAAAT Gene: VIBHAR_06946: Predicted porin for beta-glucosides	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -207 score = 5.94558 sequence = AAATGAAAGCGATTTCAAGC Gene: VS_II1393: Predicted porin for beta-glucosides	* Vibrio vulnificus CMCP6 Site: position = -164 score = 6.04776 sequence = AAATGAAACCGATTTCAAAT Gene: VV21281: Predicted porin for beta-glucosides	Predicted porin for beta-glucosides

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog BglR - Vibrionales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --