Regulog BglR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | ||
| Vibrio angustum S14 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 | ||
| Vibrio fischeri ES114 | ||
| Vibrio harveyi ATCC BAA-1116 | 8 | 2 |
| Vibrio parahaemolyticus RIMD 2210633 | ||
| Vibrio salmonicida LFI1238 | ||
| Vibrio shilonii AK1 | ||
| Vibrio splendidus LGP32 | 8 | 2 |
| Vibrio vulnificus CMCP6 | 7 | 2 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| bglR |
|
|
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -60 score = 5.46461 sequence = CCATGAAAGCGGTTTCGGAG Gene: VIBHAR_06943: Transcriptional regulator for beta-glucoside utilization, LacI family |
|
|
|
*
Vibrio splendidus LGP32 Site: position = -41 score = 5.00469 sequence = TTTTGTAAGCGGTTACAAGC Site: position = -140 score = 5.65031 sequence = ATCTGTAAGCGCTTTCATGA Gene: VS_II1392: Transcriptional regulator for beta-glucoside utilization, LacI family |
*
Vibrio vulnificus CMCP6 Site: position = -48 score = 5.57639 sequence = GCATGAAAGCGGTTTCGAAA Gene: VV21282: Transcriptional regulator for beta-glucoside utilization, LacI family |
Transcriptional regulator for beta-glucoside utilization, LacI family |
| bglE |
|
|
|
|
2
Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06941: Predicted beta-glucoside ABC transporter, periplasmic component Gene: VIBHAR_06942: Predicted beta-glucoside ABC transporter, periplasmic component |
|
|
|
Gene: VS_II1391: Predicted beta-glucoside ABC transporter, periplasmic component |
Gene: VV21283: Predicted beta-glucoside ABC transporter, periplasmic component |
Predicted beta-glucoside ABC transporter, periplasmic component |
| bglF |
|
|
|
|
Gene: VIBHAR_06940: Predicted beta-glucoside ABC transporter, permease component |
|
|
|
Gene: VS_II1390: Predicted beta-glucoside ABC transporter, permease component |
Gene: VV21284: Predicted beta-glucoside ABC transporter, permease component |
Predicted beta-glucoside ABC transporter, permease component |
| bglG |
|
|
|
|
Gene: VIBHAR_06939: Predicted beta-glucoside ABC transporter, permease component |
|
|
|
Gene: VS_II1389: Predicted beta-glucoside ABC transporter, permease component |
Gene: VV21286: Predicted beta-glucoside ABC transporter, permease component |
Predicted beta-glucoside ABC transporter, permease component |
| bglB |
|
|
|
|
Gene: VIBHAR_06938: Beta-glucosidase (EC 3.2.1.21) |
|
|
|
Gene: VS_II1388: Beta-glucosidase (EC 3.2.1.21) |
Gene: VV21287: Beta-glucosidase (EC 3.2.1.21) |
Beta-glucosidase (EC 3.2.1.21) |
| bglK |
|
|
|
|
Gene: VIBHAR_06937: Predicted beta-glucoside ABC transporter, ATP-binding protein |
|
|
|
Gene: VS_II1387: Predicted beta-glucoside ABC transporter, ATP-binding protein |
Gene: VV21288: Predicted beta-glucoside ABC transporter, ATP-binding protein |
Predicted beta-glucoside ABC transporter, ATP-binding protein |
| VS_II1386 |
|
|
|
|
|
|
|
|
Gene: VS_II1386: Cellodextrin-phosphorylase (EC 2.4.1.49) |
|
Cellodextrin-phosphorylase (EC 2.4.1.49) |
| CRON 2. | |||||||||||
| bglP |
|
|
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -206 score = 6.1657 sequence = AAATGAAAGCGATTTCAAAT Gene: VIBHAR_06946: Predicted porin for beta-glucosides |
|
|
|
*
Vibrio splendidus LGP32 Site: position = -207 score = 5.94558 sequence = AAATGAAAGCGATTTCAAGC Gene: VS_II1393: Predicted porin for beta-glucosides |
*
Vibrio vulnificus CMCP6 Site: position = -164 score = 6.04776 sequence = AAATGAAACCGATTTCAAAT Gene: VV21281: Predicted porin for beta-glucosides |
Predicted porin for beta-glucosides |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |