Regulon of BglR in Vibrio splendidus LGP32

Properties
Regulator type:	Transcription factor
TF locus tag:	VS_II1392
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Vibrionales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -207 Score: 5.9 Sequence: AAATGAAAGCGATTTCAAGC Locus tag: VS_II1393 Name: bglP Funciton: Predicted porin for beta-glucosides
	VS_II1393	bglP	Predicted porin for beta-glucosides
Position: -140 Score: 5.7 Sequence: ATCTGTAAGCGCTTTCATGA Position: -41 Score: 5 Sequence: TTTTGTAAGCGGTTACAAGC Locus tag: VS_II1392 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: VS_II1391 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: VS_II1390 Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VS_II1389 Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VS_II1388 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: VS_II1387 Name: bglK Funciton: Predicted beta-glucoside ABC transporter, ATP-binding protein Locus tag: VS_II1386 Name: VS_II1386 Funciton: Cellodextrin-phosphorylase (EC 2.4.1.49)
	VS_II1392	bglR	Transcriptional regulator for beta-glucoside utilization, LacI family
	VS_II1391	bglE	Predicted beta-glucoside ABC transporter, periplasmic component
	VS_II1390	bglF	Predicted beta-glucoside ABC transporter, permease component
	VS_II1389	bglG	Predicted beta-glucoside ABC transporter, permease component
	VS_II1388	bglB	Beta-glucosidase (EC 3.2.1.21)
	VS_II1387	bglK	Predicted beta-glucoside ABC transporter, ATP-binding protein
	VS_II1386	VS_II1386	Cellodextrin-phosphorylase (EC 2.4.1.49)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD