Regulon of BglR in Vibrio vulnificus CMCP6

Properties
Regulator type:	Transcription factor
TF locus tag:	VV21282
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Vibrionales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -164 Score: 6 Sequence: AAATGAAACCGATTTCAAAT Locus tag: VV21281 Name: bglP Funciton: Predicted porin for beta-glucosides
	VV21281	bglP	Predicted porin for beta-glucosides
Position: -48 Score: 5.6 Sequence: GCATGAAAGCGGTTTCGAAA Locus tag: VV21282 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: VV21283 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: VV21284 Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VV21286 Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VV21287 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: VV21288 Name: bglK Funciton: Predicted beta-glucoside ABC transporter, ATP-binding protein
	VV21282	bglR	Transcriptional regulator for beta-glucoside utilization, LacI family
	VV21283	bglE	Predicted beta-glucoside ABC transporter, periplasmic component
	VV21284	bglF	Predicted beta-glucoside ABC transporter, permease component
	VV21286	bglG	Predicted beta-glucoside ABC transporter, permease component
	VV21287	bglB	Beta-glucosidase (EC 3.2.1.21)
	VV21288	bglK	Predicted beta-glucoside ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD