Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing bglG gene

Properties
Regulog: BglR - Vibrionales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Proteobacteria/gamma
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio harveyi ATCC BAA-1116
Position: -60
Score: 5.46461
Sequence: CCATGAAAGCGGTTTCGGAG
Locus tag: VIBHAR_06943
Name: bglR
Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: VIBHAR_06942
Name: bglE
Funciton: Predicted beta-glucoside ABC transporter, periplasmic component
Locus tag: VIBHAR_06941
Name: bglE
Funciton: Predicted beta-glucoside ABC transporter, periplasmic component
Locus tag: VIBHAR_06940
Name: bglF
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: VIBHAR_06939
Name: bglG
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: VIBHAR_06938
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: VIBHAR_06937
Name: bglK
Funciton: Predicted beta-glucoside ABC transporter, ATP-binding protein
bglR-bglE-bglE-bglF-bglG-bglB-bglK -60 5.5 CCATGAAAGCGGTTTCGGAG VIBHAR_06943
Vibrio splendidus LGP32
Position: -140
Score: 5.65031
Sequence: ATCTGTAAGCGCTTTCATGA
Position: -41
Score: 5.00469
Sequence: TTTTGTAAGCGGTTACAAGC
Locus tag: VS_II1392
Name: bglR
Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: VS_II1391
Name: bglE
Funciton: Predicted beta-glucoside ABC transporter, periplasmic component
Locus tag: VS_II1390
Name: bglF
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: VS_II1389
Name: bglG
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: VS_II1388
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: VS_II1387
Name: bglK
Funciton: Predicted beta-glucoside ABC transporter, ATP-binding protein
Locus tag: VS_II1386
Name: VS_II1386
Funciton: Cellodextrin-phosphorylase (EC 2.4.1.49)
bglR-bglE-bglF-bglG-bglB-bglK-VS_II1386 -140 5.7 ATCTGTAAGCGCTTTCATGA VS_II1392
-41 5 TTTTGTAAGCGGTTACAAGC
Vibrio vulnificus CMCP6
Position: -48
Score: 5.57639
Sequence: GCATGAAAGCGGTTTCGAAA
Locus tag: VV21282
Name: bglR
Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: VV21283
Name: bglE
Funciton: Predicted beta-glucoside ABC transporter, periplasmic component
Locus tag: VV21284
Name: bglF
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: VV21286
Name: bglG
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: VV21287
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: VV21288
Name: bglK
Funciton: Predicted beta-glucoside ABC transporter, ATP-binding protein
bglR-bglE-bglF-bglG-bglB-bglK -48 5.6 GCATGAAAGCGGTTTCGAAA VV21282