Regulon of BglR in Vibrio harveyi ATCC BAA-1116

Properties
Regulator type:	Transcription factor
TF locus tag:	VIBHAR_06943
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Vibrionales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -206 Score: 6.2 Sequence: AAATGAAAGCGATTTCAAAT Locus tag: VIBHAR_06946 Name: bglP Funciton: Predicted porin for beta-glucosides
	VIBHAR_06946	bglP	Predicted porin for beta-glucosides
Position: -60 Score: 5.5 Sequence: CCATGAAAGCGGTTTCGGAG Locus tag: VIBHAR_06943 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: VIBHAR_06942 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: VIBHAR_06941 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: VIBHAR_06940 Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VIBHAR_06939 Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VIBHAR_06938 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: VIBHAR_06937 Name: bglK Funciton: Predicted beta-glucoside ABC transporter, ATP-binding protein
	VIBHAR_06943	bglR	Transcriptional regulator for beta-glucoside utilization, LacI family
	VIBHAR_06942	bglE	Predicted beta-glucoside ABC transporter, periplasmic component
	VIBHAR_06941	bglE	Predicted beta-glucoside ABC transporter, periplasmic component
	VIBHAR_06940	bglF	Predicted beta-glucoside ABC transporter, permease component
	VIBHAR_06939	bglG	Predicted beta-glucoside ABC transporter, permease component
	VIBHAR_06938	bglB	Beta-glucosidase (EC 3.2.1.21)
	VIBHAR_06937	bglK	Predicted beta-glucoside ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD