Regulog CelR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By TF family - LacI
- By effector - Cellobiose-6-phosphate
- By pathway - Cellobiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | 7 | 2 |
| Vibrio angustum S14 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 | 7 | 2 |
| Vibrio fischeri ES114 | ||
| Vibrio harveyi ATCC BAA-1116 | 7 | 2 |
| Vibrio parahaemolyticus RIMD 2210633 | 7 | 2 |
| Vibrio salmonicida LFI1238 | ||
| Vibrio shilonii AK1 | ||
| Vibrio splendidus LGP32 | ||
| Vibrio vulnificus CMCP6 | 7 | 2 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| celG |
*
Photobacterium profundum SS9 Site: position = -286 score = 6.40943 sequence = AAGCGCAACCGGTTGCGCGA Gene: PBPRA0494: oligosaccharide deacetylase |
|
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -179 score = 6.84134 sequence = AAGCGCAACCGGTTGCGTTA Gene: VC1280: oligosaccharide deacetylase |
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -184 score = 6.64276 sequence = AAGCGCAACCGGTTGCATTG Gene: VIBHAR_03626: oligosaccharide deacetylase |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -183 score = 6.95307 sequence = AAGCGCAACCGGTTGCGCTA Gene: VP2638: oligosaccharide deacetylase |
|
|
|
*
Vibrio vulnificus CMCP6 Site: position = -206 score = 6.64276 sequence = AAGCGCAACCGGTTGCATTG Gene: VV1_1481: oligosaccharide deacetylase |
oligosaccharide deacetylase |
| CRON 2. | |||||||||||
| celB |
*
Photobacterium profundum SS9 Site: position = -150 score = 6.73565 sequence = TCGCGCAACCGGTTGCGCTT Gene: PBPRA0495: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
|
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -83 score = 6.93866 sequence = TAACGCAACCGGTTGCGCTT Gene: VC1281: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -84 score = 6.67895 sequence = CAATGCAACCGGTTGCGCTT Gene: VIBHAR_03625: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -84 score = 7.05039 sequence = TAGCGCAACCGGTTGCGCTT Gene: VP2637: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
|
|
|
*
Vibrio vulnificus CMCP6 Site: position = -127 score = 6.67895 sequence = CAATGCAACCGGTTGCGCTT Gene: VV1_1482: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
| celD |
Gene: PBPRA0496: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
|
Gene: VC1282: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
|
Gene: VIBHAR_03624: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
Gene: VP2636: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
|
|
|
Gene: VV1_1483: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
| celA |
|
|
Gene: VC1283: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
|
Gene: VIBHAR_03623: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
Gene: VP2635: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
|
|
|
Gene: VV1_1484: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
| bglA |
Gene: PBPRA0497: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
Gene: VC1284: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
Gene: VIBHAR_03622: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
Gene: VP2634: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
|
|
Gene: VV1_1485: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
6-phospho-beta-glucosidase (EC 3.2.1.86) |
| celE |
Gene: PBPRA0498: Cellobiose phosphotransferase system YdjC-like protein |
|
Gene: VC1285: Cellobiose phosphotransferase system YdjC-like protein |
|
Gene: VIBHAR_03621: Cellobiose phosphotransferase system YdjC-like protein |
Gene: VP2633: Cellobiose phosphotransferase system YdjC-like protein |
|
|
|
Gene: VV1_1486: Cellobiose phosphotransferase system YdjC-like protein |
Cellobiose phosphotransferase system YdjC-like protein |
| celR |
2
Photobacterium profundum SS9 Gene: PBPRA0499: Transcriptional regulator for cellobiose utilization, LacI family Gene: PBPRA0500: Transcriptional regulator for cellobiose utilization, LacI family |
|
Gene: VC1286: Transcriptional regulator for cellobiose utilization, LacI family |
|
Gene: VIBHAR_03620: Transcriptional regulator for cellobiose utilization, LacI family |
Gene: VP2632: Transcriptional regulator for cellobiose utilization, LacI family |
|
|
|
Gene: VV1_1487: Transcriptional regulator for cellobiose utilization, LacI family |
Transcriptional regulator for cellobiose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |