Regulon of CelR in Photobacterium profundum SS9

Properties
Regulator type:	Transcription factor
TF locus tag:	PBPRA0499
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose-6-phosphate
Regulog:	CelR - Vibrionales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Cellobiose-6-phosphate
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -286 Score: 6.4 Sequence: AAGCGCAACCGGTTGCGCGA Locus tag: PBPRA0494 Name: celG Funciton: oligosaccharide deacetylase
	PBPRA0494	celG	oligosaccharide deacetylase
Position: -150 Score: 6.7 Sequence: TCGCGCAACCGGTTGCGCTT Locus tag: PBPRA0495 Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: PBPRA0496 Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: PBPRA0497 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: PBPRA0498 Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein Locus tag: PBPRA0499 Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family Locus tag: PBPRA0500 Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family
	PBPRA0495	celB	PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
	PBPRA0496	celD	PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
	PBPRA0497	bglA	6-phospho-beta-glucosidase (EC 3.2.1.86)
	PBPRA0498	celE	Cellobiose phosphotransferase system YdjC-like protein
	PBPRA0499	celR	Transcriptional regulator for cellobiose utilization, LacI family
	PBPRA0500	celR	Transcriptional regulator for cellobiose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD