Regulon of CelR in Vibrio parahaemolyticus RIMD 2210633

Properties
Regulator type:	Transcription factor
TF locus tag:	VP2632
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose-6-phosphate
Regulog:	CelR - Vibrionales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Cellobiose-6-phosphate
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -183 Score: 7 Sequence: AAGCGCAACCGGTTGCGCTA Locus tag: VP2638 Name: celG Funciton: oligosaccharide deacetylase
	VP2638	celG	oligosaccharide deacetylase
Position: -84 Score: 7.1 Sequence: TAGCGCAACCGGTTGCGCTT Locus tag: VP2637 Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: VP2636 Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: VP2635 Name: celA Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) Locus tag: VP2634 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: VP2633 Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein Locus tag: VP2632 Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family
	VP2637	celB	PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
	VP2636	celD	PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
	VP2635	celA	PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
	VP2634	bglA	6-phospho-beta-glucosidase (EC 3.2.1.86)
	VP2633	celE	Cellobiose phosphotransferase system YdjC-like protein
	VP2632	celR	Transcriptional regulator for cellobiose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD