Regulon of CelR in Vibrio cholerae O1 biovar eltor str. N16961

Properties
Regulator type:	Transcription factor
TF locus tag:	VC1286
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose-6-phosphate
Regulog:	CelR - Vibrionales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Cellobiose-6-phosphate
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -179 Score: 6.8 Sequence: AAGCGCAACCGGTTGCGTTA Locus tag: VC1280 Name: celG Funciton: oligosaccharide deacetylase
	VC1280	celG	oligosaccharide deacetylase
Position: -83 Score: 6.9 Sequence: TAACGCAACCGGTTGCGCTT Locus tag: VC1281 Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: VC1282 Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: VC1283 Name: celA Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) Locus tag: VC1284 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: VC1285 Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein Locus tag: VC1286 Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family
	VC1281	celB	PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
	VC1282	celD	PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
	VC1283	celA	PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
	VC1284	bglA	6-phospho-beta-glucosidase (EC 3.2.1.86)
	VC1285	celE	Cellobiose phosphotransferase system YdjC-like protein
	VC1286	celR	Transcriptional regulator for cellobiose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD