Regulog ScrR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LacI
- By effector - Sucrose
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | 3 | 2 |
| Bacillus cereus ATCC 14579 | ||
| Bacillus clausii KSM-K16 | 5 | 1 |
| Bacillus halodurans C-125 | ||
| Bacillus licheniformis DSM 13 | 6 | 2 |
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | ||
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 | 5 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| scrR |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -169 score = 7.31438 sequence = TATGTCAATCGGTTGACATA Gene: RBAM_031840: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
Gene: ABC3120: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
*
Bacillus licheniformis DSM 13 Site: position = -157 score = 7.58808 sequence = TATGTCAACCGGTTGACATA Gene: BLi04183: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
|
|
|
*
Paenibacillus sp. JDR-2 Site: position = -122 score = 7.31438 sequence = TATGTCAACCGGATGACATA Gene: Pjdr2_5212: Sucrose utilization transcriptional regulator ScrR, LacI family |
Sucrose utilization transcriptional regulator ScrR, LacI family |
| CRON 2. | ||||||||||||
| sacH |
|
|
|
*
Bacillus clausii KSM-K16 Site: position = -83 score = 7.58808 sequence = TATGTCAACCGGTTGACATA Gene: ABC3119: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein |
|
Gene: BLi04181: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein |
|
|
|
|
*
Paenibacillus sp. JDR-2 Site: position = -103 score = 7.31438 sequence = TATGTCATCCGGTTGACATA Gene: Pjdr2_5213: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein |
Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein |
| sacG |
|
|
|
Gene: ABC3118: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2 |
|
Gene: BLi04180: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2 |
|
|
|
|
Gene: Pjdr2_5214: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2 |
Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2 |
| sacF |
|
|
|
Gene: ABC3117: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein |
|
*
Bacillus licheniformis DSM 13 Site: position = -97 score = 7.58808 sequence = TATGTCAACCGGTTGACATA Gene: BLi04182: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein |
|
|
|
|
Gene: Pjdr2_5215: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein |
Predicted fructose oligosaccharide ABC transporter, substrate-binding protein |
| sacC |
|
|
|
Gene: ABC3116: Levanase (EC 3.2.1.65) |
|
|
|
|
|
|
Gene: Pjdr2_5216: Levanase (EC 3.2.1.65) |
Levanase (EC 3.2.1.65) |
| cscA |
Gene: Aflv_1213: Sucrose hydrolase (EC 3.2.1.26) |
Gene: RBAM_031820: Sucrose hydrolase (EC 3.2.1.26) |
|
Gene: ABC3115: Sucrose hydrolase (EC 3.2.1.26) |
|
Gene: BLi04178: Sucrose hydrolase (EC 3.2.1.26) |
|
|
|
|
|
Sucrose hydrolase (EC 3.2.1.26) |
| cscB |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -241 score = 7.31438 sequence = TATGTCAACCGATTGACATA Gene: RBAM_031830: Sucrose permease, major facilitator superfamily |
|
|
|
Gene: BLi04179: Sucrose permease, major facilitator superfamily |
|
|
|
|
|
Sucrose permease, major facilitator superfamily |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |